Informations

Où puis-je obtenir la séquence du précurseur d'ARN ribosomique d'E. coli ?

Où puis-je obtenir la séquence du précurseur d'ARN ribosomique d'E. coli ?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

J'ai trouvé des séquences séparées pour l'ARNr 16S (de la petite sous-unité) et l'ARNr 23S et l'ARNr 5S (de la grande sous-unité). J'ai besoin de la séquence d'ARNr précurseur complète, que je ne trouve pas.

Cependant la séquence complète annotée du génome d'E. coil est disponible :

https://www.ncbi.nlm.nih.gov/nuccore/U00096.3?report=fasta

Changer le T en U de cette séquence me donne-t-il la séquence complète de l'ARNr ?


Généralement, la plupart des organismes ont plusieurs copies des gènes/régions codant pour l'ARN ribosomique (car il en faut beaucoup). De plus, ces régions peuvent être répétitives ou similaires à la séquence ou se placer correctement dans le génome, il est donc généralement plus difficile de trouver de bonnes séquences génomiques pour l'ARNr par rapport à d'autres gènes.

D'après votre lien, il semble que vous recherchiez l'ARNr d'E.coli ; l'entrée GeneBank correspondant au fichier fasta que vous avez lié contient l'annotation du génome complet et comporte 7 entrées pour des ensembles d'ARN ribosomique (nommés rr[slf][A-H]*).
Si vous prenez l'une des séquences couvrant l'une de ces régions, vous devriez obtenir la séquence du précurseur complet. Cependant, il y a des choses que vous devez savoir :

  • il y aura probablement des différences de séquence mineures entre les 7 régions
  • Apparemment, la plupart des opérons d'ARNr d'e.coli contiennent également des gènes d'ARNt mélangés (ceux-ci sont différents pour les 7 opérons)
  • remplacer le T génomique par U fera ressembler la séquence à de l'ARN, mais l'ARN ribosomique est souvent également édité après la transcription, de sorte que la séquence que vous obtenez peut ne pas correspondre entièrement à la séquence d'ARNr mature.

Un autre site Web qui donne une meilleure visibilité sur les opérons d'ARNr dans e.coli est celui-ci, il contient également des liens sources et semble correspondre à l'entrée de la banque de gènes d'après ce que je peux voir.

Exemple sur la façon de trouver la région d'ARNr à partir de l'entrée geneBank :

Il s'agit d'une partie (abrégée) de l'annotation de l'entrée GeneBank, qui montre les gènes ribosomiques « A » :

gène 4035531… 4037072 /gene="rrsA" ARNr 4035531… 4037072 /gene="rrsA" gène 4037141… 4037217 /gene="ileT" ARNt 4037141… 4037217 /gene="ileT" gène 4037260… 4037335 /gene="alaT" ARNt 4037260… 4037335 /gene="alaT" gène 4037519… 4040423 /gene="rrlA" ARNr 4037519… 4040423 /gene="rrlA" gène 4040517… 4040636 /gene="rrfA" ARNr 4040517… 4040636 /gene="rrfA"

Comme vous pouvez le voir les gènes dans la région/opernoccur dans l'ordre rrsA, ileT, >alaT, rrlA, rrF (le fait qu'il s'agisse d'un opéron ne peut pas être déduit de l'entrée GeneBank) et si vous prenez la région correspondante du fasta (nucléotides/caractères 4035531 à 4040636), vous obtiendrez (la plupart de) la séquence de transcription primaire.
Étant donné que les séquences de promoteur et de terminateur ne sont pas annotées dans GeneBank (ou dans la plupart des autres assemblages de génomes), vous ne pouvez pas facilement obtenir la séquence avant le premier et après le dernier gène. Une source potentielle pour ceux-ci pourrait être l'autre ressource que j'ai liée, qui répertorie certaines sources pour les sites de terminaison.

* Ceci exprime tous les noms sous forme de regex. c'est-à-dire que pour l'opéron A d'ARNr, il y a rrlA, rrsA & rrfA; idem pour B,C,…


Structure cryo-EM du E. coli traduire le ribosome en complexe avec la SRP et son récepteur

Nous rapportons la conformation 'précoce' de la Escherichia coli particule de reconnaissance de signal (SRP) et son récepteur FtsY liés au ribosome de traduction, tel que déterminé par cryo-EM. FtsY se lie à la tétraboucle de l'ARN SRP, alors que les domaines NG de la protéine SRP et FtsY interagissent faiblement dans cette conformation. Nos résultats suggèrent que le positionnement optimal de la tétraboucle d'ARN SRP et du domaine Ffh NG conduit au recrutement de FtsY.


<p>Cette section fournit toutes les informations utiles sur la protéine, principalement des connaissances biologiques.<p><a href='/help/function_section' target='_top'>Plus. </a></p> Fonction i

Divers

<p>Le projet <a href="http://www.geneontology.org/">Gene Ontology (GO)</a> fournit un ensemble de vocabulaire contrôlé hiérarchiquement divisé en 3 catégories :<p><a href='/help/ gene_ontology' target='_top'>Plus. </a></p> GO - Fonction moléculaire i

    Source : CAFA <p>Inféré à partir d'un dosage direct</p> <p>Utilisé pour indiquer un dosage direct pour la fonction, le processus ou le composant indiqué par le terme GO.</p> & #xd <p>Plus d'informations dans le <a href="http://geneontology.org/page/guide-go-evidence-codes#ida">guide des codes de preuves GO</a></p> Déduit à partir de essai je

      GO - Processus biologique i

        Source : EcoCyc <p>Inferred from Mutant Phenotype</p> <p>Décrit les annotations résultant de l'examen des variations ou des changements dans un produit génique, telles que des mutations ou des niveaux anormaux, et inclut des techniques telles que les knock-out , surexpression, expériences antisens et utilisation d'inhibiteurs de protéines spécifiques.</p> <p>Plus d'informations dans le <a href="http://geneontology.org/page/guide-go-evidence- codes#imp">guide des codes de preuves GO</a></p> Déduit à partir du phénotype mutant i

          <p>UniProtKB Keywords constitue un <a href="http://www.uniprot.org/keywords">vocabulaire contrôlé</a> avec une structure hiérarchique. Les mots-clés résument le contenu d'une entrée UniProtKB et facilitent la recherche de protéines d'intérêt.<p><a href='/help/keywords' target='_top'>Plus. </a></p> Mots-clés i

          Bases de données d'enzymes et de voies

          Collection BioCyc de bases de données de voies/génomes


          <p>Cette section fournit des informations sur le(s) nom(s) et synonyme(s) de protéine et de gène et sur l'organisme qui est la source de la séquence protéique.<p><a href='/help/names_and_taxonomy_section' target='_top'> Suite. </a></p> Noms & Taxonomie i

          <p>Informations organisées manuellement qui sont basées sur des déclarations dans des articles scientifiques pour lesquels il n'existe aucun support expérimental.</p> <p><a href="/manual/evidences#ECO:0000303"> Suite. </a></p> Assertion manuelle basée sur l'opinion en i

            <p>Un UniProt <a href="http://www.uniprot.org/manual/proteomes%5Fmanual">protéome</a> peut être constitué de plusieurs composants.<br></br>Le nom du composant fait référence au codage du composant génomique un ensemble de protéines.<p><a href='/help/proteome_component' target='_top'>Plus. </a></p> Composant i : Chromosome Composant i : Chromosome

          Chow, L. J. molec. Biol. 113, 611–621 (1977).

          Deonier, R. & Hadley, R. La nature 264, 191–193 (1976).

          Saedler, H. & Heiss, B. Molec. gén. Genet. 122, 266–277 (1973).

          Ohtsubo, H. & Ohtsubo, E. Proc. nat. Acad. Sci. ETATS-UNIS. 75, 615–620 (1978).

          Ghosal, D., Sommer, H. & Saedler, H. Acides nucléiques Res. 6, 111–122 (1979).

          Starlinger, P. & Saedler, H. Cour. Sujets Microbiol. Immun. 75, 111–152 (1976).

          Bukhari, A., Shapiro, J. & Adhya, A. (eds) Éléments d'insertion d'ADN, plasmides et épisomes (Laboratoire Cold Spring Harbor, New York, 1977).

          Alwine, J.C., Kemp, D. et Stark, G. Proc. nat. Acad. Sci. ETATS-UNIS. 74, 5350–5354 (1977).

          Nisen, P., Prucker, M. & Shapiro, L. (en préparation).

          Rak, B. Molec. gén. Genet. 149, 135–140 (1976).

          De Crombrugghe, B., Adhya, S., Gottesman, M. & Pastan, I. Nature nouveau Biol. 241 260–264 (1973).

          Brosius, J., Palmer, M. L., Kennery, P. J. et amp Noller, H. F. Proc. nat. Acad. Sci. ETATS-UNIS. 75, 4801–4805 (1978).

          Korn, L.J., Queen, C.L. & amp Wegman, M.N. Proc. nat. Acad. Sci. ETATS-UNIS. 74, 4401–4405 (1977).

          Sutcliffe, J.G. Acides nucléiques Res. 5, 2721–2728 (1978).

          Fiers, W. et al. La nature 273, 113–130 (1978).

          Sures, I. Lowry, J. & Kedes, L. H. Cellule 15, 1033–1044 (1978).

          Sanger, F. et al. J. molec. Biol. 125, 225–246 (1978).

          Post, L., Strycharz, G., Nomura, M., Lewis, H. & amp Dennis, P. Proc. nat. Acad. Sci. ETATS-UNIS. 76, 1697–1701 (1979).

          Kuhn, S., Fritz, H.J. et Starlinger, P. Molec. gén. Genet. 167, 235–241 (1979).

          Rigby, B., Dieckmann, M., Rhodes, C. & Berg, P. J. molec. Biol. 113, 237–251 (1977).


          DISPONIBILITÉ DES DONNÉES

          Les données de séquençage ont été déposées dans le Gene Expression Omnibus du NCBI (105) et sont accessibles via le numéro d'accession de la série GEO GSE152974 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE152974) . Les données de protéomique de spectrométrie de masse ont été déposées au Consortium ProteomeXchange (106) via le référentiel partenaire PRIDE (107) avec l'identifiant de jeu de données PXD019900 (https://www.ebi.ac.uk/pride/archive/projects/PXD019900). Le logiciel utilisé et les fichiers résultants ont été déposés chez Zenodo (https://doi.org/10.5281/zenodo.3876866 et https://doi.org/10.5281/zenodo.3955585).


          Matériaux et méthodes

          La recherche d'homologie a été effectuée avec BLAST (Altschul etਊl., 1990), en utilisant la base de données des organismes modèles. La distribution phylogénétique résultante des hits BLAST a été utilisée pour déduire si des protéines orthologues pouvaient être trouvées au-delà des entérobactéries, gamma protéobactéries, protéobactéries et bactéries, et si des orthologues pouvaient être trouvés chez Eukarya et Archaea. L'inspection visuelle des résultats de la recherche a été utilisée pour filtrer les protéines paralogues plutôt qu'orthologues. Dans les cas douteux, une recherche BLAST réciproque, avec une protéine orthologue putative identifiée dans la recherche originale, a été effectuée pour vérifier si la protéine utilisée comme appât pour la recherche initiale se trouverait comme son homologue le plus proche parmi les protéines de E. coli.

          Dans toutes les expériences, les souches ΔrsmG (JW3718), ΔrsmD (JW3430), ΔrsmB (JW3250), ΔrsmC (JW4333), ΔrsmH (JW0080), ΔrsmF (JW5301), ΔrsmE), & (JW2913) #x394rsmJ (JW5672), ΔrsmA(ksgA) (JW0050), ΔrlmA (JW1811), ΔrlmC (JW2756), ΔrlmF (JW5107), ΔrlmG (JW5513), ΔrlmH , ΔrlmD (JW0843), ΔrlmI (JW5898), ΔrlmJ (JW3466), ΔrlmK/L (JW0931), ΔrlmB (JW4138), ΔrlmM (JW2777), ΔrlmN ( ) et ΔrlmE (JW3146) de la collection Keio (Baba etਊl., 2006) ont été utilisées et comparées à la souche parentale de type sauvage BW25113 (Datsenko et Wanner, 2000).

          Pour l'analyse de l'expression de l'ARNr MT, une culture d'une nuit d'E. coli de type sauvage a été diluée en triple dans un milieu LB frais à A260 0,01 et cultivée à 37 °C dans un agitateur. Des aliquotes de cellules ont été prélevées à 1, 2, 3, 4, 5, 6, 7 et 56 h et utilisées pour la purification de l'ARN total avec le réactif Trizol (Invitrogen), suivie d'une synthèse d'ADNc avec un kit de synthèse d'ADNc Maxima First Strand pour RT-qPCR (Thermo) avec une amorce hexamère aléatoire ou une transcriptase inverse Superscript (Invitrogen). La PCR quantitative a été réalisée par une ADN polymérase Maxima Hot Start (Thermo) en présence de vert SYBR. Les amorces suivantes ont été utilisées pour l'amplification des ARNm indiqués : rsmA(ksgA) (CCCTTTTGCGGGTTAATGGC et ACGCTTCGGGCAAAACTTTC), rsmB (CTATGCCACCTGTTCGGTGT et CTGTTTCGCAAAGTTCGGCA), rsmC (GCGCATAATCTGCCAGCATC et AAAGACCAAACCG), rsmD (CGCAAAAAGGTACACCGCAT et CAGCCAGCCGTTATCTTCCA), rsmE (TGAGCAGTGTGGTCGTAACCet ACCGGTAACGGCAACGTATT), rsmF(CCGATTTTCTCGGTTGGGGA et ATACCACTCCTCCGCTTCCT), rsmG (GGACGCACGATAGAGAGGTGGet TTCGGTCCGCGATCCTAATG), rsmH (CTCACGTCTGATCCTCTCGC et CAATAGTCTTCGCAACGGCG), rsmJ (AATTCCAGATGTTCCGGCGT et TGCCTTATCTGTTCTGGCGG), rlmA (AAATCAGCCCCTTCAGCTCC et CCGATACCAGTATGGACGCC), rlmB (GCCAGGACGTCAGTATCAGG et AGGATCAGCAGGAACGGTTG), rlmC (GGGCTTTGGTTTACACTGCG et AAACTGAGTGGAGTCCAGCG), rlmD (TCGACAATGTCACTGGAGCC et GATGTTCCCTGGGGCTATCG), rlmE (AGGTCGACAACCGTCATTCC et AAAGGGGTTACGTTCCCGTG), rlmF (CATCACAGCCGCTACGATCTet AAGTCTACGCTTTGCTCCCC), rlmG (AATGCCAGTGTTTTTCGGCAC et ACGGGATTGATGAGTCGAGC), rlmH (TGCTCACCCTCTTTGTCGAG et TTTACCGAGTACCTGCGTCG), rlmI (ATCGCGATAAGTACGCAGCA et GAAGCGCTGGATATTGCACG), rlmJ (CAGTTAGGCAGCGAACATGC et CTGACCGCTACGGTTGAAGT), rlmKL (TTTGAAACGTCTGCTGCGTG et CAGGCCGTCGAGATCCATAC), rlmM (CTTCAACACGCAGTTCACCG et CATTTGCCGCCAGAAGATCG), rlmN (ATGTCGATGGCTTCACCCTG et TATCGATGCTGCCTGTGGTC), oppA (AATCGTTCTTGAACGCAGC et GATCAACGTGAACTTCGTCC), metK (AGGCTGAAGTGCGTAAAAAC et GGGCAGAATTGGCTTGATG), nanA (GTGGTGTACAACATTCCAGC et CGAAGATTTCGTCGTAACCG), gatY (TTTGCCATCGCTTTGATGTC et TGGCATACATCCCATGAGC), guaB (AAGACTTCCAGAAAGCGGAA et TTCACGGATACGTTGCAGTA), mdaB (CAGCGACTACGATGTCAAAG et TTTTCGACGGATCTTTGCG), ybeD (CAGGCGTTACCTGAGCTG et TTTGCCCAGTTCTTCATACAGT), astC (ATTGACGACTCTACCTGTGC et TCACGCCGTAGTGCATATAG), acs (GCAGTATTCCGCTGAAGAAA et GATCTTCGGCGTTCATCTCT), modA (GCCTGCGGATCTGTTTATTT et TTCAGCAGTGAAGTCCAGTT), psp (ATCGATGTTCGTGTTCCAGA et CCCATCTCGCTAAGGATCTC), ugpB (GCTGGATCCAACTGGAAAAC et TTCATCCTTACGACCGACG), argT (TACCGATAAACGTCAGCAGG et CCTTTACTACGCCAGGTCTC), sra (AATCGAACCGTCAGGCAC et TTTTCAGCGGGGGGCGTTT), cer (TGAGCAAGGGCGAGGAGC et TGGTGCAGATGAACTTCAGG), rfp (GCTGATCAAGGAGAACATGC et AGGATGTCGAAGGCGAAGG). La quantification de l'expression a été effectuée par la méthode Δ㥌t en utilisant l'ARNr 16S comme référence (gAgAATgTgCCTTCgggAAC et CCgCTggCAACAAAggATAA pour l'analyse de l'expression des gènes MT ou CATTGACGTTACCCGCAGAAGAAG et CTACGAGACTCAAGCTTGCCAGTA pour les autres analyses de l'expression des gènes). Pour estimer la proportion de traitement de l'ARNr 17S, une approche intermédiaire RT qPCR a été utilisée. Les séquences d'amorces suivantes ont été utilisées pour l'ARNr 16S (GAAGAGTTTGATCATGGCTCAG et CCACTCGTCAGCAAAGAAG) et pour l'intermédiaire de traitement de l'ARNr 17S (TCATTACGAAGTTTAATTCTTTGAGCG et GAAGAGTTTGATCATGGCTCAG). La proportion 17S/(16S +�S) a été calculée en normalisant les niveaux du transcrit 17S étendu 5′ à la quantité totale de transcrits 16S et 17S.

          Pour évaluer l'accumulation d'intermédiaires d'assemblage, des cellules d'ARNr MT knock-out et d'une souche BW25113 (WT) ont été cultivées dans 500 ml d'un milieu LB à 37ଌ ou 20ଌ à A600 0,6, refroidi lentement sur de la glace et récolté par centrifugation. Les culots de cellules ont été remis en suspension dans un tampon de lyse (20 mM HEPES-KOH pH 7,5, 4,5 mM Mg(OAc)2, 150 mM NH4Cl, 4 mM β-mercaptoéthanol, 0,05 mM de spermine, 2 mM de tampon spermidine) et lysé par ultrasonication. Après élimination des débris cellulaires, des lysats contenant environ 1 200 pmol de ribosomes ont été appliqués à un gradient de saccharose de 10 à 30 % dans un tampon 20 mM HEPES-KOH pH 7,5, 1 mM Mg(OAc)2, 200 mM NH4Cl, 4 mM β-mercaptoéthanol, ou un gradient de 10 % à 40 % de saccharose dans un tampon 20 mM HEPES-KOH pH 7,5, 10 mM Mg(OAc)2, 200 mM NH4Cl, 4 mM β-mercaptoéthanol. L'ultracentrifugation a été réalisée par un rotor SW41Ti à 19 000 tr/min pendant 19 h suivi d'un contrôle de la densité optique à 260 nm.

          Pour créer une construction pRFPCERtet, un plasmide pRFPCER (Osterman etਊl., 2013) a été digéré avec HindIII et SacII et ligaturé avec une paire d'oligonucléotides complémentaires pré-annelés (TetR F 5′ AGCTTGGGAAATCATAAAAAATTATTTGCTTACTCTATCATTGATAGAGTTATAATAGCCG-3 x2032-GGCTATTATAACTCTATCAATGATAGAGTAAGCAAATAATTTTTTATGATTTCCCA-3′), contenant un promoteur T5 avec le site de liaison TetR. Le plasmide obtenu a été digéré avec les enzymes de restriction SacII et NdeI et ligaturé avec une paire d'oligonucléotides complémentaires pré-annelés (5′-CACACAACAAAGGAGGTAC et 5′-TAGTACCTCCTTTGTGTTGTGTGGC), contenant un site de liaison ribosomique très efficace. Le plasmide résultant a été utilisé pour une étude plus approfondie en tant que pRFPCERtet.

          Pour surveiller les taux de croissance lors de la surexpression de gènes exogènes et pour évaluer l'efficacité de la synthèse des protéines, des cellules de souches knockout MT d'ARNr et la souche BW25113 (WT) ont été transformées avec le plasmide pRFPCERtet. Des cultures d'une nuit des transformants, en triple pour chaque souche, ont été diluées par LB avec ou sans anhydrotétracycline 0,2 ug/ml à A600 0,01 dans une plaque 96 puits. Les cellules ont été cultivées sous agitation continue à 37 ° C avec A automatique600 surveillance toutes les 30 min par un poste de travail Janus (Perkin Elmer). Les taux de croissance des souches knock-out de l'ARNr MT et de la souche de type sauvage non transformée par aucun plasmide ont été mesurés de la même manière.

          Pour l'évaluation de l'efficacité de la synthèse des protéines CER et RFP, les cellules transformées par le plasmide pRFPCERtet ont été cultivées en triple pendant 18 h dans 200 ul de milieu LB à 37 ° C avec ou sans anhydrotétracycline 0,2 ug/ml dans une plaque à 96 puits profonds avec agitation continue. Après incubation, les cellules ont été centrifugées dans une plaque à 96 puits et lavées deux fois avec 0,9% de NaCl. La fluorescence des cellules a été mesurée par un lecteur de plaques Victor X5 (Perkin Elmer) à 430/486 nm pour CER et 531/595 nm pour RFP.

          Déterminer in vivo efficacité de synthèse protéique, les cellules des souches knock-out MT de type sauvage et ARNr ont été transformées par un plasmide codant pour la protéine FastFT sous contrôle d'un promoteur araBAD (Subach etਊl., 2009). Les cellules cultivées dans des milieux LB avec 10 mM d'arabinose à 37 °C après 48 h ont été diluées au 1:100 par un milieu LB frais avec 10 mM d'arabinose. Une aliquote a été prélevée à différents moments. Les cellules ont été isolées par centrifugation, lavées deux fois avec du PBS stérile et analysées par un trieur de cellules BD FACSAria III activé par fluorescence aux longueurs d'onde 405/460 nm et 555/610 nm.

          L'analyse comparative du protéome à l'aide de la PAGE 2D a été réalisée comme décrit (Hoch etਊl., 2015). Pas moins de trois cultures cultivées indépendamment ont été utilisées pour chaque souche knock-out.

          L'analyse comparative du protéome au fusil de chasse a été effectuée comme décrit (Toprak etਊl., 2014 Osterman etਊl., 2015). En bref, les cellules remises en suspension dans 0,75% p/p RapiGest SF (Waters) ont été lysées par sonication. Après élimination des débris, les liaisons protéine cystéine ont été réduites avec 10 mM de dithiothréitol et alkylées avec 30 mM d'iodoacétamide. La trypsine a été ajoutée dans un rapport trypsine/protéine de 1/50 p/p et incubée à 37 °C pendant une nuit. Pour arrêter la trypsinolyse, de l'acide trifluoroacétique (TFA) a été ajouté à la concentration finale de 0,5% v/v. Les peptides ont été dessalés et remis en suspension dans 3% d'acétonitrile (ACN), 0,1% de TFA, à une concentration finale de 2 µg/µl. L'analyse par spectrométrie de masse a été réalisée sur un spectromètre de masse TripleTOF 5600+ avec une source d'ions NanoSpray III (ABSciex, Canada) couplée à un système nano-HPLC NanoLC Ultra 2D+ (Eksigent). Pour l'identification des protéines, les fichiers de données .wiff ont été analysés avec ProteinPilot 4.5 révision 1656 (ABSciex) en utilisant l'algorithme de recherche Paragon 4.5.0.0 révision 1654 (ABSciex) et un ensemble standard de paramètres d'identification pour rechercher dans la base de données SwissProt, les espèces Escherichia coli.


          3. Conclusion

          Plusieurs conclusions peuvent être tirées de ces études en ce qui concerne les stabilités et les structures relatives des ARN avec des nucléotides modifiés simples et multiples. Petites différences reproductibles dans les valeurs d'énergie libre pour le E. coli Les variantes h31 révèlent de légers effets déstabilisants des modifications sur l'hélice 31. Une structure cristalline aux rayons X récente du T. thermophilus Le ribosome 70S complexé avec un ARNm modèle et deux ARNt a révélé que les positions des nucléotides du site P de l'ARNr 16S dans le ribosome vacant se superposent bien avec celles du complexe contenant l'ARNt, à l'exception de m2 2 G966. 16 m de résidus2 2 G966 (m2G966 dans E. coli ribosomes) est retourné dans la structure cristalline du T. thermophilus Ribosome 70S contenant un ARNm modèle et deux ARNt ( Figure 4A ) 15 , 16 ou reste empilé dans la sous - unité ribosomique 30S de T. thermophilus structure cristalline (figure 4B). 22 L'interaction avec la boucle anticodon de l'ARNt lié au site P semble être stabilisée par des interactions d'empilement impliquant m2 2 G966 avec le ribose 34. Par conséquent, la base retournée a été suggérée pour faciliter le positionnement correct de l'ARNt pendant la traduction. 16, 25 Par conséquent, les légers effets déstabilisants des modifications dans h31 peuvent être importants pour faciliter le mouvement de retournement du résidu 966, mais en même temps, les interactions d'empilement avec l'ARNt sont stabilisées par le groupe méthyle. Positionné au milieu des trois bases empilées, le résidu m 5 C967 a un effet déstabilisant plus important que le m 2 G966 (ECh31M5C vs. ECh31M2G). Ce résultat peut être dû à une perturbation plus importante de l'empilement par la base méthylée du m 5 C967.

          Structures de h31 montrant les conformations retournées (A) et empilées (B) du résidu G966 (ID d'accession PDB - 2J00 15 et 1FJF 22).

          Les données CD indiquent que les ARN non modifiés, modifiés individuellement et entièrement modifiés contiennent tous des régions souches de forme A et présentent des conformations similaires. Des différences mineures entre les spectres CD des constructions h31 entièrement modifiées et non modifiées indiquent des différences possibles dans les régions de boucle. Ces différences pourraient provenir de changements dépendant des modifications dans la boucle, tels qu'un empilement de base modifié aux positions 966, 967 et 968. Les données de fusion UV révèlent, cependant, que la présence de modifications à des emplacements spécifiques n'influence pas la capacité du construits pour former des structures de boucle en épingle à cheveux stables.

          Le rôle fonctionnel exact des modifications aux positions 966 et 967 de h31 est encore inconnu. Les ribosomes effectuent le processus biochimique essentiel de la traduction, ce qui nécessite une gamme exquise d'interactions hautement spécifiques entre l'ARNr, l'ARNm, les ARNt et les protéines ribosomiques. On pense que les modifications aident à affiner la fonction du ribosome. 3 Étant donné que le bon fonctionnement du ribosome dépend du bon équilibre entre vitesse et précision de la liaison de l'ARNt, de la formation de liaisons peptidiques et de la libération de l'ARNt, les méthylations dans h31 pourraient jouer un rôle dans le maintien d'interactions appropriées au sein du ribosome. 36, 37 Les analyses mutationnelles ont révélé qu'une perte de méthylation à la position 966 ou 967, conduit à une production accrue de protéines par les ribosomes mutants. 21 Nos données suggèrent donc que les méthylations déstabilisent h31 afin de maintenir les interactions appropriées avec l'ARNt, l'ARNr ou les protéines. Un manque de modification au niveau des résidus 966 ou 967 en h31 pourrait réduire la capacité de la base 966 à basculer et à réguler l'affinité, le positionnement ou la précision de l'ARNt. Ainsi, il sera d'un grand intérêt d'explorer plus en détail la relation entre la méthylation de G966 et C967 et la fidélité traductionnelle. En outre, la disponibilité d'une méthode appropriée pour synthétiser le m 2 G et son phosphoramidite correspondant (non disponible dans le commerce) permettra de générer des ARN contenant des modifications m 2 G en quantités suffisamment importantes pour être utilisés dans des études biophysiques et de liaison de ligand supplémentaires.


          Discussion

          L'utilisation de CRISPR/Cas9 pour l'édition du génome a eu un impact profond dans le domaine de la biologie synthétique et, plus important encore, continue d'ouvrir de nouvelles voies pour la médecine translationnelle telles que les thérapies géniques 37 . Dans cette étude, nous avons utilisé le potentiel de CRISPR/Cas9 et la capacité innée de recombinaison homologue de la levure pour concevoir la petite sous-unité d'ARN ribosomique dans le génome bactérien de M. mycoides. En outre, nous avons également testé la fonction des mutations nouvellement introduites en transplantant le génome avec le gène d'ARNr 16S modifié chez le receveur. M. capricolum cellules 27 . Ainsi, nous avons été en mesure de générer une plate-forme d'ingénierie du génome qui peut être utilisée pour une mutagenèse dirigée robuste et étendue directement sur le chromosome bactérien avec une efficacité allant jusqu'à 100 %.

          Les ARN ribosomiques sont l'un des gènes les plus conservés dans les trois règnes de la vie, souligné par le fait que l'ARN à petite sous-unité est utilisé pour mesurer le taux d'évolution des organismes et les classer phylogénétiquement en fonction de la divergence dans la séquence de ce gène. Outre la nature conservée, l'ingénierie de l'ARNr 16S présente un défi considérable également en raison du nombre de copies des gènes de l'ARN ribosomique qui varie entre 1 et 15 dans le domaine Bactéries 20 . La redondance fonctionnelle de diverses copies de l'ARNr a été démontrée chez quelques espèces eubactériennes telles que E. coli 21 ,22 et M. smegmatis 23 ,24 ainsi que chez l'eucaryote, Saccharomyces cerevisiae 38 qui a permis l'ingénierie d'organismes avec des populations homogènes de ribosomes codés par des unités de transcription uniques. Ainsi, le problème du nombre de copies a été contourné en utilisant des organismes modèles tels que M. smegmatis, qui n'a que deux copies des gènes d'ARNr 23 ,24 et E. coli souches avec un seul opéron d'ARNr codé à partir d'un plasmide ou du chromosome 21,22. De même, le M. mycoides le génome ne porte que deux opérons d'ARNr, et surtout, la suppression d'un opéron n'affecte pas la viabilité des cellules (Hutchison et al. 29). Par conséquent, cela fait M. mycoides un modèle idéal pour l'ingénierie de l'ARNr 16S et du ribosome. Cependant, le manque d'outils génétiques a limité l'utilisation de M. mycoides en tant qu'organisme modèle pour étudier les processus biologiques fondamentaux malgré les nombreux exploits révolutionnaires de la biologie synthétique accomplis avec son génome 25,26,27. L'une de ces réalisations, à savoir le clonage du génome bactérien entier dans la levure, nous a permis d'appliquer les outils génétiques développés dans la levure sur le M. mycoides génome, ce qui en fait une plate-forme polyvalente pour l'édition du génome bactérien. Grâce à la capacité unique de cette plateforme, nous avons pu générer une version du génome dépourvue du gène essentiel de l'ARNr 16S, ce qui n'est pas possible par les techniques conventionnelles. Par la suite, la fonctionnalité de ce génome non fonctionnel a été restaurée en utilisant une version de type sauvage ou une version modifiée du gène qui pourrait prendre en charge la fonction du ribosome. De plus, nous avons pu tester la fonction de plusieurs versions du gène d'ARNr 16S modifié dans une seule transformation de levure et la M. mycoides événement de transplantation de génome (tableau supplémentaire 1), créant ainsi la possibilité de tests fonctionnels à haut débit de plusieurs loci via cette plate-forme.

          Le but de cette étude n'était pas de comprendre systématiquement si chaque segment de la M. mycoides rrs gène est essentiel à sa fonction. Notre étude visait plutôt à utiliser les M. mycoides génome cloné dans la levure comme plate-forme pour explorer les possibilités d'ingénierie de ce gène essentiel en identifiant les sites où des modifications de séquence pourraient être introduites et dans quelle mesure de telles modifications pourraient être tolérées. Au cours du processus, nous avons constaté que l'introduction de l'hélice de liaison aux protéines d'enveloppe MS2 (MS2) était l'élément hétérologue le plus toléré puisque cinq des six rrs* la réalisation de cette modification à différents endroits n'a pas affecté la viabilité cellulaire. Notamment, dans E. coli, l'introduction de MS2 à h6 n'a pas affecté la viabilité cependant, cela n'a entraîné que

          85 % des petites sous-unités marquées par MS2 lors de la purification par affinité 34 . Compte tenu de nos résultats avec MS2, peut-être que l'introduction de MS2 sur plusieurs sites simultanément aurait pu encore permettre des ribosomes pleinement fonctionnels et une viabilité cellulaire dans E. coli et récupéré une fraction beaucoup plus élevée des sous-unités marquées MS2. De même, l'introduction de l'élément MS2 à plusieurs endroits dans l'ARNr à grande sous-unité aurait pu entraîner une population plus pure que celle observée.

          90 % lorsqu'ils sont marqués sur un seul site 34 . A noter également, le problème de l'hétérogénéité des mutations non létales est contourné dans le M. mycoides plate-forme, puisque le gène de type sauvage est complètement éliminé avant l'introduction du gène de l'ARNr 16S mutagénisé.

          Il est intéressant de noter que les six sites choisis pour l'ingénierie (h6-h39) étaient capables de tolérer au moins un seul type d'élément d'insertion ( Fig. 3A ), indiquant que pour le rrs* portant des insertions qui n'ont pas produit de greffes viables, le site n'était pas la raison en soi. Cependant, le contexte des éléments d'insertion pourrait avoir joué un rôle dans le repliement de l'ARNr suite à la transcription, aux modifications post-transcriptionnelles, à l'association de protéines ribosomiques ou à la stabilité de l'ARNr, affectant ainsi l'assemblage et la fonction des petites sous-unités et par conséquent, la viabilité cellulaire. Par exemple, il a été démontré que l'insertion d'hélices synthétiques “s” diminue légèrement la fidélité du ribosome (moins de deux fois) en termes de lecture de codon stop et de décalage de trame 33 . Cependant, une connaissance fonctionnelle détaillée de la façon dont chacune de ces six hélices contribue à la fonction du ribosome est en grande partie inconnue. L'intégrité structurelle et donc la fonctionnalité des hélices natives sont largement préservées lors de l'ajout d'éléments hétérologues, tandis que les substitutions d'hélices s'écartent considérablement dans la séquence et par conséquent, dans la structure de l'hélice (Fig. 2B,D). Cela pourrait potentiellement expliquer pourquoi la plupart des substitutions d'hélices entières étaient mortelles, seulement 2/12 substitutions d'hélices simples ont produit des greffes viables par opposition à 11/18 insertions d'hélices. Au contraire, nous avons observé une perte de viabilité lorsque deux éléments d'insertion distincts ont été introduits à deux endroits différents simultanément (Fig. 3B), même si nous avons observé une viabilité lorsque h17 et h39 ont été substitués simultanément avec ceux de B. subtilis et E. coli, respectivement (le triple site conçu rrs* qui étaient fonctionnels portaient ces deux substitutions, figure 3C).

          Alors que les éléments d'insertion ont déjà fait leurs preuves dans E. coli 33 ,34 ,35 ,36 , il était encore surprenant de noter que plusieurs de ces ajouts à site unique pouvaient soutenir la viabilité, étant donné la distance phylogénétique considérable de l'ARNr 16S entre E. coli et M. mycoides (Fig. 3 supplémentaire). Plus impressionnant encore, nous avons pu générer des fonctionnalités rrs* conçu jusqu'à trois emplacements (Fig. 3c) dans le gène par une conception soignée, ce qui démontre clairement la flexibilité fournie par l'architecture de l'ARNr 16S. Cette flexibilité pourrait être exploitée pour ajouter de nouvelles fonctions à la machinerie de traduction telles que l'orthogonalité et également pour étudier les fonctions centrales des ribosomes telles que l'initiation et le décodage en introduisant des mutations. A noter également, toutes les variantes à site unique, double et triple ont été testées sur le M. mycoides rrs qui portait déjà sept mutations du M. capricolum rrs gène. Il est probable que peut-être encore plus de ces rrs* auraient pu être fonctionnels s'ils avaient été testés dans le contexte du type sauvage M. mycoides rrs gène, soulignant l'utilité potentielle de cette plate-forme pour générer et étudier des mutants de petites sous-unités.

          Nos efforts se sont concentrés principalement sur l'évaluation si le rrs* pourrait soutenir la production de M. mycoides cellules après transplantation du génome. Un phénotype facilement observable de l'ingénierie de l'ARNr est le défaut de croissance provoqué par les mutations introduites. Il est concevable que certaines des greffes portant rrs* ont une croissance lente lors de la culture, ce qui pourrait même expliquer dans certains cas, pourquoi les mutations qui ont produit des greffes individuellement n'ont pas produit de viables M. mycoides cellules lorsqu'elles sont combinées (Fig. 3A𠄼). De tels mutants à croissance lente pourraient être potentiellement utilisés pour étudier des processus tels que le repliement et la stabilité de l'ARNr 16S et la maturation des petites sous-unités.

          En conclusion, le M. mycoides plate-forme décrite ici pourrait permettre le test à haut débit de différentes versions mutagénisées de tout gène essentiel puisque seules les versions fonctionnelles peuvent restaurer la capacité du génome à produire des cellules viables lors de la transplantation du génome. Ainsi, cette plate-forme peut être appliquée pour mieux comprendre la fonction de diverses régions de l'ARNr 16S et pourrait être étendue à l'ARN à grande sous-unité, aux facteurs ribosomiques et extra-ribosomiques et à d'autres gènes essentiels impliqués dans les processus biologiques fondamentaux pour répondre aux questions fondamentales de la vie.


          DISCUSSION

          Les ARN ribosomiques sont les principaux composants de la machinerie traductionnelle et sont synthétisés à des niveaux élevés pour répondre aux demandes cellulaires pour la synthèse des protéines, en particulier dans des conditions de croissance rapide (24). Cependant, une description des voies qui conduisent à la génération d'ARNr matures dans E. coli est restée incomplète même si les étapes initiales du traitement de l'ARNr ont été définies il y a près de 50 ans. Sur la base des preuves suggérant que l'ARNr 5S subit une maturation 5'-end en utilisant un mécanisme exonucléolytique 5' à 3', j'ai examiné une souche qui manque de RNase AM, une exonucléase 5' à 3', et j'ai trouvé que la maturation 5'-end de L'ARNr 5S est réalisé par cette enzyme à la fois in vivo et in vitro (Figure 1). J'ai également découvert que la RNase AM est responsable de la maturation de l'extrémité 5' de l'ARNr 23S, mais cette enzyme ne supprime que les trois derniers nts des sept résidus précurseurs, indiquant la présence d'une autre enzyme qui supprime les quatre nts précédents (Figure 2) . Enfin, j'ai découvert que la RNase AM génère l'extrémité 5' mature de l'ARNr 16S (figure 4). Ce processus a été attribué à la RNase G, mais il est montré ici que le produit de clivage de la RNase G conserve trois nts non traités, qui sont ensuite éliminés par la RNase AM. La raison pour laquelle la RNase AM devrait supprimer précisément trois nts non traités de chacun des ARNr reste incertaine. Nonetheless, the identification of the enzyme that matures the 5' end of these rRNAs, in conjunction with the previously identified enzymes responsible for 3′-end maturation, now provides a full description of the enzymes that generate mature ends for each of the three rRNAs in E. coli.

          Due to the high levels of ribosomes that are required for growth, a significant proportion of transcription, and therefore, of the energy generated by a cell, is used for rRNA synthesis. A question of interest is how rRNA degradation, which would contribute to inefficiencies in energy utilization, is minimized given a cellular environment that contains multiple RNases. It has been shown that once complete ribosomes are formed, rRNA becomes extraordinarily stable in the assembled form ( 25), but a small proportion of rRNA does get degraded during the assembly process ( 26, 27). One factor that limits more extensive rRNA degradation during the assembly process could be through a restriction of the activity of rRNA processing enzymes to late stages of rRNA assembly, where over-digestion can be curbed by the presence of ribosomal proteins or rRNA structures that form during the assembly process. Supporting this view, I found that RNase AM maturation of 5S and 23S rRNA occurs not only more efficiently, but also with greater accuracy on ribosomal particles as compared to purified rRNA (Figure 1D and 2C). In the case of 23S rRNA, RNase AM processing was observed to occur at a late stage of assembly when 50S particles join with 30S particles to form the complete ribosome (Figure 3G). Similarly, it has been shown that processing of the 5S and 23S rRNAs at their 3′ ends by RNase T is also more efficient on ribosomal particles, as compared to free RNA ( 8, 9). Identifying the mechanisms through which the activity of the processing RNases is restricted on free rRNA and/or channeled to ribosomal particles will be a topic of interest for the future.

          We had previously provided experimental evidence that the 5′ and 3′ ends of 23S rRNA undergo maturation at similar rates under different growth conditions, and based on those observations, we suggested that the processing of the two ends might be coupled ( 19). This hypothesis was tested by using ΔyciV etrnb??rph strains to inhibit processing at the 5′ or 3′ ends, respectively. These analyses revealed that in a Δrnb??rph strain, 5′-end precursors accumulate to the same extent as 3′-end precursors, suggesting that 3′-end maturation occurs first and is necessary for processing at the 5′ end (Figure 3). Similarly, work on 16S rRNA has suggested that processing at one end facilitates maturation at the other end ( 10, 28). Thus, the coupled processing of 3′ and 5′ ends may be a common feature of bacterial rRNAs, with potential relevance for increasing the efficiency of rRNA maturation at both ends.

          Paralogs of RNase AM are found in a wide variety of organisms, including many other Gram-negative and positive bacteria, archaea and lower eukaryotes. However, the model Gram-positive bacterium, Bacillus subtilis lacks an RNase AM homolog. In this case, 5′-end maturation of the three rRNAs each proceeds through a different set of mechanisms, involving the enzymes Mini-III for 23S rRNA, RNase J1 for 16S rRNA and RNase M5 for 5S rRNA maturation ( 29–31). Interestingly, in some members of the delta-proteobacteria, RNase AM paralogs are found in fusion with RNase III, which suggests that multiple steps of rRNA processing might be performed by the same enzyme in these organisms. Future studies on this enzyme will be needed to clarify the rRNA maturation role of RNase AM in all domains of life. In summation, the findings described here provide answers to decades-old questions regarding the mechanism of 5′-end maturation of the E. coli rRNAs, complete the roster of the RNases required to yield mature rRNAs and describe the first biological function for a 5′ to 3′ RNA exonuclease in this organism.


          Voir la vidéo: RRNA promotional video (Août 2022).