Informations

De quelle manière la cellule de levure ferait-elle face à l'excès de méthionine dans le milieu de croissance ?

De quelle manière la cellule de levure ferait-elle face à l'excès de méthionine dans le milieu de croissance ?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Je suppose que lorsqu'il y a un surplus de méthionine dans la cellule, il est incorporé dans le cycle du TCA en tant que succinyl CoA, avec la cystéine comme sous-produit. Mais maintenant, la cellule a le surplus de cystéine. Qu'est-ce que ça fait avec ? Comment élimine-t-il l'excès de soufre de la cellule? Ce processus influencerait-il d'une manière ou d'une autre le NAD+/balance NADH ?


Chez l'homme, la cystéine remplit d'abord le pool de glutathion (qui est lui-même un réservoir de cystéine, en dehors des équivalents de réduction et de la biotransformation). L'excès de cystéine peut aller de trois façons,

  1. oxydation en sulfoalanine et en hypotaurine et taurine, via des enzymes encore inconnues
  2. dégradation en lantionine et H toxique2S
  3. dégradation en sérine et H toxique2S

Étant donné que la cystathionine gamma lyase qui (son activité L-cystéine désulfhydrase) catalyse 2 et 3 a des homologues dans la levure, je suppose que H2S y est produit aussi. Plus d'oxydation de H2S passe par une ancienne voie mitochondriale qui est également hautement conservée, produisant des sulfites et des sulfates. Le sulfate crée alors un environnement un peu acide, mais le reste n'est pas toxique.

J'ai lié aux entrées de reactome.org où vous pouvez trouver des références. Remplir le pool de glutathion de la levure (si cela se produit) déplacerait le NAD+/ Équilibre NADH du côté NADH, c'est-à-dire qu'il remplit également les équivalents de réduction.


Étudier la réponse au stress acide dans différents Saccharomyces Souches

Les cellules de levure doivent répondre à une variété de stress rencontrés dans des conditions aussi différentes que le tractus gastro-intestinal après l'ingestion de probiotiques ou la cuve de fermentation pendant la production d'éthanol. Dans la présente étude, la capacité de neutralisation de H +, la composition en acides gras membranaires, l'activité H + -ATPase et la concentration cytosolique de Ca 2+ ont été évaluées dans des cellules de levure utilisées pour les probiotiques (Saccharomyces boulardii) et laboratoire (Saccharomyces cerevisiae W303), ainsi que dans certaines souches mutantes W303 pour ENA1 gène et S. cerevisiae PAR4741. Les résultats montrent que la concentration interne en H + de la levure est régulée par plusieurs systèmes, dont la membrane plasmique H + -ATPase, et qu'Ena1p a un rôle important mais non défini dans la réponse cellulaire à l'acide. Composition membranaire en acides gras de S. cerevisiae La souche W303 a été affectée par l'exposition à un pH acide, mais la présence de 86 mM de NaCl a empêché cet effet, alors que la composition en acides gras de la membrane de S. boulardii n'était pas affecté par le pH acide. Nous avons également démontré que la réponse au stress acide dépend du métabolisme du calcium et est bloquée par le FK 506.

1. Introduction

Pour survivre et proliférer, les organismes libres doivent s'adapter aux changements de leur environnement. L'exposition de la Saccharomyces cerevisiae aux stress environnementaux, tels que les ions toxiques [1, 2], l'éthanol [3], ou les changements de température [4] ou de pH [5], déclenche des changements biochimiques et d'expression génique [6]. L'exposition rapide de la levure aux acides inorganiques est intéressante, car une telle exposition se produit dans des conditions environnementales (p. 7]).

Saccharomyces cerevisiae pousse bien sur une large gamme de pH mais pousse mieux en pH acide qu'en pH alcalin [5, 8]. Des études ont démontré des changements dans l'expression de centaines de gènes dans S. cerevisiae suite à des altérations du pH [9–11]. Les réponses de S. cerevisiae à pH alcalin ont été revues par Ariño [5] et impliquent diverses voies de signalisation. En particulier, le rôle de la calcineurine sur le stress alcalin a été suggéré très tôt, et l'implication de la signalisation calcique dans cette réponse a été rapportée dans des travaux ultérieurs [5, 10, 12, 13]. Des réponses au pH alcalin ont également été décrites pour Candida albicans [14] et Aspergillus nidulans [15, 16].

Les réponses au stress acide ont été étudiées dans des cellules de levure artificiellement exposées à des acides organiques faibles [9, 17], des conservateurs alimentaires [17, 18] et des herbicides [19]. En réponse à l'exposition à des acides faibles, les cellules de levure présentent une diminution de la perméabilité membranaire, une extrusion d'anions, une capacité accrue à cataboliser les conservateurs [20] et une expression génique altérée [9]. Les résultats de l'analyse à l'échelle du génome et du criblage fonctionnel des gènes impliqués dans la réponse aux acides lactique, acétique et chlorhydrique suggèrent que les conditions acides affectent l'architecture de la paroi cellulaire, l'expression des gènes impliqués dans le métabolisme des métaux, la H + -ATPase vacuolaire (V-ATPase) et Taux de protéines HOG MAPK [17].

Semblable à la réponse aux acides faibles, la résistance à l'exposition aux acides inorganiques implique des changements dans la conductivité membranaire à H + , l'extrusion active de protons de la cellule [21] et la modulation de l'expression des gènes [8, 17]. Des études antérieures ont montré que la voie de la protéine kinase C (PKC) impliquée dans l'intégrité cellulaire dans S. cerevisiae est activé en réponse au stress acide et que cette activation dépend du capteur de paroi cellulaire Mid2p [22–24]. Claret et al. ont suggéré l'existence de deux voies distinctes, impliquant Mid2p (capteur de paroi cellulaire) ou Rgd1p (voie Hog) qui agissent ensemble pour induire la voie de l'intégrité cellulaire et augmenter la tolérance aux acides [22].

Dans Saccharomyces, le calcium cytosolique joue un rôle essentiel dans le contrôle du cycle cellulaire, du processus de bourgeonnement et de l'accouplement. De plus, le calcium cytosolique est un second messager important dans les cellules eucaryotes. Les cellules de levure se développant dans des conditions de laboratoire standard présentent de faibles niveaux de calcium cytosolique et une activité de calcineurine minimale [25]. L'exposition à divers stress environnementaux, tels que le stress salin, oxydatif, alcalin ou thermique, provoque des modifications immédiates du calcium cytosolique. Les niveaux de calcium augmentent d'abord puis diminuent rapidement lorsque les cellules de levure sont exposées à ces conditions [10, 14, 26-28]. Crz1 est le principal effecteur de l'expression génique régulée par la calcineurine dans S. cerevisiae, mais des cibles non identifiées pour la calcineurine avec des rôles dans l'adaptation au stress existent également [5]. Les protéines Cch1 et Mid1, composants du canal calcique membranaire et effecteurs de Slt2p (voie PKC) sont impliquées dans la viabilité cellulaire à faible pH dans Saccharomyces [22]. Cependant, les mécanismes de signalisation médiés par le calcium n'ont pas été étudiés dans le cadre de la réponse au choc acide.

Dans un précédent travail réalisé dans notre laboratoire, nous avons établi que de faibles concentrations d'ions sodium conféraient une protection aux cellules de levure exposées au stress acide [29]. Nos observations suggèrent également que les systèmes impliqués dans le maintien du potentiel de la membrane plasmique (PMA1p H + -ATPase et systèmes de transport secondaire) sont liés à la réponse au stress acide. Dans la présente étude, nous avons concentré des expériences sur la participation de la membrane plasmique H + -ATPase et sur les événements de signalisation du calcium observés dans les cellules de levure en réponse au stress acide.

2. Matériels et méthodes

2.1. Souches de levure et conditions de croissance

Le tableau 1 répertorie les souches de levure utilisées dans cette étude. Les souches de levure ont été cultivées dans un agitateur orbital (200 tr/min) à 30°C dans un milieu YPD contenant (p/v) 1 % d'extrait de levure, 2 % de peptone et 2 % de glucose. La croissance cellulaire a été suivie par densité optique (DO) à 600 nm.

2.2. Tests de condition de stress acide et de viabilité

ont été récoltés par centrifugation à 4 750 ×g pendant 5 min et lavés deux fois avec du milieu YP. Ensuite, les culots ont été mis en suspension à une DO600 nm de 1,0 dans une solution aqueuse, préalablement ajustée à pH 2,0 avec du HCl 1 M et additionné de 86 mM de NaCl. Cette condition a été appliquée à chaque traitement acide effectué dans cette étude. Les échantillons de levure ont ensuite été incubés dans un agitateur orbital à 30°C pendant 1 h. Des aliquotes ont été recueillies après 0 (cellules témoins, avant le stress acide), 15, 30 et 60 min d'incubation. Les cellules ont été immédiatement lavées deux fois avec un volume égal de YP et diluées 20 000 x. Ensuite, 50

L de suspension cellulaire a été ensemencée sur gélose YPD. Les plaques ont été incubées à 30°C pendant 48 à 72 h. Les résultats ont été exprimés en pourcentage (%) d'unités formant colonie (ufc) par rapport à l'échantillon témoin (

La croissance de cellules de levure en présence de Na+ a été testée sur une série de plaques YPD supplémentées avec des concentrations croissantes de NaCl (200-500 mM). Des dilutions en série au dixième de suspensions cellulaires ont été préparées et des aliquotes de 5 L de chacune ont été déposées sur des plaques YP. La croissance a été suivie pendant 3 jours.

2.3. H + Capacité de neutralisation des cellules de levure

La capacité des cellules à neutraliser le H+ ajouté à une suspension cellulaire a été déterminée par une technique d'impulsion acide avec un pH-mètre. En bref, le pH a été mesuré après l'ajout d'impulsions acides [30]. Pour estimer la capacité extracellulaire à neutraliser le H+ ajouté, les cellules ont été cultivées comme décrit précédemment, lavées et exposées (cellules stressées) ou non (cellules témoins) à un stress acide. Des aliquotes de 50 ml ont été recueillies par centrifugation, lavées deux fois avec de l'eau Milli-Q et remises en suspension dans un volume de 2 ml pour obtenir une suspension cellulaire dense. Le pH de la suspension cellulaire a été préalablement ajusté à pH 6,8 avec du NaOH et les premières impulsions d'acide ont été effectuées avec de petits volumes de HCl 10 mM, car près de la plage de pH neutre, même l'ajout de petites quantités de protons entraîne de grands changements de pH. Pour estimer la capacité totale des cellules à neutraliser H + (c'est-à-dire la capacité des groupes chimiques dérivés de la surface cellulaire et des métabolites internes), les cellules ont été préalablement perturbées avec de l'azote liquide dans de l'eau Milli-Q et remises en suspension comme décrit précédemment.

2.4. Détermination de l'activité H + -ATPase

Les mesures de l'activité H + -ATPase ont été faites avec 375 mg de cellules (poids humide) cultivées dans du YPD (4% de glucose) jusqu'à une DO600 de 1,0 à 1,2 (témoin) ou des cellules cultivées dans du YPD, lavées, exposées à un stress acide, comme décrit ci-dessus, et récoltées après 10, 30 et 60 min. Après récupération sur des filtres en fibre de verre, les cellules ont été retirées des filtres, immédiatement congelées dans de l'azote liquide et stockées jusqu'à utilisation. L'isolement de la membrane plasmique et la détermination de l'activité ATPase, en présence d'inhibiteurs de l'ATPase et de la phosphatase mitochondriale, ont été réalisés comme décrit précédemment [31]. La teneur en protéines a été déterminée par la méthode de Lowry [32].

2.5. Concentration de calcium libre intracellulaire

La concentration en calcium libre cytosolique a été mesurée par la méthode à base d'équorine [33] avec quelques modifications. Le plasmide pVTU-AEQ était un don de Marco Vanoni (Università di Milano-Bicocca, Milan, Italie). En bref, des cellules à croissance exponentielle transformées avec le plasmide multicopie exprimant l'apoaequorine pVTU-AEQ ont été récoltées par centrifugation à 4 750 ×g pendant 5 min, lavées trois fois avec Mes/Tris 0,1 M (pH 6,5) et remises en suspension à une densité de

10 9 cellules/mL. Pour reconstituer l'équorine fonctionnelle, 50 M de coelenterazine (solution mère de Molecular Probes 1 g/L dissous dans du méthanol) ont été ajoutés à la suspension cellulaire, et les cellules ont été incubées pendant 30 min à température ambiante dans l'obscurité. L'excès de coelenterazine a été éliminé en lavant les cellules trois fois avec de l'eau Milli-Q et en centrifugant à 3 200 xg pendant 3 min.

Pour chaque impulsion d'acide (pH 2,0 plus 86 mM de NaCl), 450 L de suspension cellulaire (dans l'eau) ont été transférés dans un tube de luminomètre. L'émission de lumière a été surveillée dans un luminomètre Berthold Lumat LB 9501/16 à des intervalles de 2 s en commençant 1 min avant et durant jusqu'à >6 min après l'ajout de HCl à la concentration finale indiquée sur les figures. Les résultats résument trois réplicats et sont exprimés en unités de luminescence relative par seconde (RLU/s).

2.6. Analyse de la composition en acides gras membranaires

Le système d'identification microbienne (MIS, Microbial ID Inc., Newark, DE, USA) a été utilisé pour analyser la composition en acides gras des membranes cytoplasmiques [34]. Les esters méthyliques ont été obtenus selon la méthode MIDI (Microbial ID Inc.). Les esters méthyliques ont été identifiés et quantifiés par chromatographie avec le progiciel Sherlock (MIDI Inc., version 4.5). Des transformations de racine carrée arcsinus ont été effectuées. Les données ont été analysées par analyse de variance (ANOVA) avec le test de Scott Knott à 5% de signification. Les transformations et les analyses ont été réalisées avec le logiciel Genes, version 2007.0.0, qui permet l'étude de la diversité génétique microbienne à partir de la composition en acides gras membranaires [35]. Les données ont été analysées par la distance euclidienne standardisée, et la distance matricielle calculée a été utilisée pour l'analyse de clustering par la méthode UPGMA (Unweighted Pair Group Method with Arithmetic Mean).

2.7. Méthodes de biologie moléculaire

La préparation et la manipulation des acides nucléiques (par exemple, l'extraction au phénol, la précipitation à l'éthanol et l'électrophorèse) ont été effectuées comme décrit par Sambrook et al. [36].

Les plasmides p417-CYC (copie faible) et p427-TEF (copie élevée), achetés auprès de Dualsystems Biotech AG, Suisse, ont été utilisés pour exprimer ENA1 (YDR040C, Saccharomyces cerevisiae Base de données du génome, http://www.yeastgenome.org/). L'insert a été préparé en utilisant l'ADN génomique de levure de la souche W303 comme matrice. Les amorces étaient en avant, GACTAGTATG GGCGAAGGAACTACTAAG et inverse, TCCCCCGGGTCATTGTTTAT ACCAATATTAAC. L'amorce PCR directe contenait un site Spe1 et l'amorce inverse avait un site Smal. Le produit de PCR a été coupé avec Spe1/Smal et inséré dans des vecteurs Spe/Sma1 p417-CYC ou p427-TEF pour produire les plasmides recombinants.

Compétent Escherichia coli Top10F’ les cellules souches ont été transformées avec les plasmides recombinants, pour l'expression d'Ena1p ou d'aequorine. La présence de l'insert approprié a été déterminée par extraction d'ADN, suivie d'une digestion et d'un séquençage avec la méthode de terminaison de chaîne (Système d'analyse de séquençage MegaBace 1000 et kit de terminaison de colorant DynamicTM ET). Les séquences d'acides nucléiques ont été comparées aux séquences du Saccharomyces Base de données du génome.

Pour les tests d'activité H + -ATPase et de bioluminescence, des cellules de levure ont été transformées par la méthode au lithium [37].

2.8. Reproductibilité des résultats

Toutes les expériences ont été réalisées en triple. Les moyennes ± SD sont indiquées sur chaque figure, à l'exception des expériences de neutralisation de H + et de signal de calcium.

3. Résultats

3.1. H + Capacité de neutralisation

Les résultats précédents de notre laboratoire ont montré que S. boulardii (une souche probiotique) est plus résistante à un pH bas que S. cerevisiae W303 (souche non probiotique de laboratoire). Par conséquent, nous avons décidé de tester le comportement de ces souches face à une impulsion acide (pH 2,0 plus 86 mM de NaCl ou un environnement gastrique simulé sans pepsine). Comme décrit précédemment, une faible concentration de NaCl semble protéger les cellules de levure contre le stress des acides inorganiques, empêchant ainsi une mort cellulaire exacerbée due à des conditions extrêmes. La figure 1 montre la capacité de neutralisation extracellulaire et totale (extracellulaire et intracellulaire) de H + de S. boulardii et S. cerevisiae Cellules W303 cultivées en YPD (témoin) et cellules préalablement exposées au stress acide. Les capacités extracellulaires de S. cerevisiae W303 et S. boulardii pour neutraliser le H + ajouté étaient similaires, mais S. cerevisiae W303 était légèrement plus affecté par les impulsions acides que S. boulardii (Figure 1(a)). Les résultats ont également démontré que la capacité extracellulaire à neutraliser le H+ ajouté était inférieure à la capacité totale pour les deux souches de levure (figures 1(a) et 1(b)). Cette différence est particulièrement évidente lorsque l'on observe le pH résultant après l'ajout d'une quantité spécifique de H + /mg de cellules. Saccharomyces boulardii avait une capacité de neutralisation totale de H + plus élevée et peut-être une plus grande capacité à maintenir l'homéostasie du pH après un stress acide que S. cerevisiae W303 (figure 1(b)), suggérant que les deux souches ont des compositions différentes de composés tampons intracellulaires. Le pH résultant après l'ajout de 1000 nmol H + /mg de cellules était de 3,3 et 2,8 (dans les cellules témoins ou exposées à pH 2,0 + 86 mM NaCl, resp.) pour S. boulardii et pH 2,6 et 2,2 pour W303 (figure 1(b)). Ce mécanisme tampon est important pour un ajustement rapide du pH intracellulaire mais ne peut pas s'adapter à des changements extrêmes du pH extracellulaire. En fait, une différence de 0,5 unité de pH dans le milieu extérieur, dans la plage de pH faible, représente une condition de stress prononcée.


(une)
(b)
(une)
(b) Capacité de neutralisation H + des cellules de levure cultivées dans un milieu YPD, déterminée par une technique d'impulsion acide. (a) Capacité de neutralisation extracellulaire H + de S. boulardii (●), S. boulardii exposé à pH 2,0 + 86 mM NaCl (o), S. cerevisiae W303 (■), et S. cerevisiae W303 exposé à pH 2,0 + 86 mM NaCl (□). (b) H total + capacité de neutralisation de S. boulardii (●), S. boulardii exposé à pH 2,0 + 86 mM NaCl (o), S. cerevisiae W303 (■), et S. cerevisiae W303 exposé à pH 2,0 + 86 mM NaCl (□).
3.2. Composition membranaire en acides gras

La composition et les niveaux d'acides gras dans la membrane cellulaire ont été modulés en réponse au stress acide, comme le montre un dendrogramme illustré à la figure 2. Une augmentation passive de la concentration de protons intracellulaires peut expliquer en partie cette réponse cellulaire à l'acide. Cet effet a été particulièrement prononcé dans la souche W303, dans laquelle des changements dans le profil des acides gras ont été observés après 30 min d'exposition acide (pH 2,0). De faibles augmentations ont été observées pour l'acide oléique et l'acide arachidique, tandis que le pourcentage d'acide gadoléique, un acide cis-icos-9-énoïque apparenté à l'acide oléique mais possédant 20 atomes de carbone, a présenté une forte diminution. La figure 2 montre également que l'ajout de 86 mM de NaCl a empêché cet effet dans la souche W303 et que la composition membranaire en acides gras de S. boulardii n'était pas affecté par le pH acide. On sait que l'insaturation des chaînes d'acides gras a un effet profond sur la fluidité membranaire, mais des travaux supplémentaires seront nécessaires pour étudier si les changements dans les degrés de saturation et d'insaturation influencent la tolérance aux acides.


Dendrogramme de la composition en acides gras des membranes cytoplasmiques de levure. Les données ont été analysées par la distance euclidienne standardisée, et la distance matricielle calculée a été utilisée pour l'analyse de clustering par la méthode UPGMA. La composition et les niveaux d'acides gras dans la membrane cellulaire ont été modulés en réponse au stress acide, en particulier dans la souche W303, et cet effet a été empêché par l'ajout de 86 mM de NaCl comme le montre le dendrogramme.
3.3.Activité H + -ATPase chez les mutants Ena

Pour confirmer l'implication des systèmes impliqués dans le maintien du potentiel membranaire plasmique (PMA1/H + -ATPase et systèmes de transport secondaire) lors de la réponse au stress acide, nous avons construit des souches de levure exprimant différents niveaux d'Ena1p. Alors que Pma1p est impliquée dans l'extrusion active des protons, les protéines ENA agissent dans les réponses au stress salin ou alcalin [38] et aident à réguler le potentiel de la membrane plasmique [29]. Saccharomyces cerevisiae contient plusieurs gènes codant pour les protéines ENA mais le ENA1 Le gène est le composant le plus fonctionnel du groupe de gènes [38]. La figure 3 montre l'activation in vivo de la membrane plasmique H + -ATPase par impulsion acide (pH 2,0 + 86 mM NaCl) dans des souches de levure avec différents niveaux d'Ena1p. La souche de délétion (W303 ena1::HIS3::ena4), le W303 ena1::HIS3::ena4 souche transformée avec les vecteurs vides, et la souche exprimant une seule copie de ENA1 (W303 ena1::HIS3::ena4 + p417::ENA1) a montré une activation de la H + -ATPase induite par l'acide. En revanche, aucune activation n'a été observée dans Saccharomyces souches exprimant des taux élevés d'Ena1p (W303 et W303 ena1::HIS3::ena4 + p427::ENA1). Le tableau 2 montre que ena1Δ le mutant a présenté une tolérance plus élevée au stress acide lorsque la viabilité des souches avec différents niveaux d'Ena1p a été comparée au type sauvage S. cerevisiae W303 (expression ENA élevée) au fil du temps. Ces résultats ont été confirmés par des tests ponctuels lorsque des dilutions en série par dix de cellules témoins et soumises à un stress acide ont été déposées sur des plaques YPD (résultats non présentés). Les potentiels de membrane les plus négatifs dans des conditions de croissance standard de ena des mutants nuls et des cellules avec une faible expression d'Ena1p pourraient expliquer la corrélation entre les niveaux d'ENA1, l'activation de la membrane plasmique H + -ATPase induite par l'acide et la tolérance aux acides comme démontré dans une étude précédente [29]. En revanche, les souches surexprimant Ena1p ont des potentiels membranaires plus positifs et ne sont pas sensibles à l'activation de la H + -ATPase induite par l'acide. La souche exprimant une copie unique (ou au maximum deux copies d'ENA1) a montré une viabilité inférieure par rapport à S. boulardii (faible expression d'ENA1 et résistance aux acides, travaux antérieurs [29]) peut-être parce que W303 ena1::HIS3::ena4 + p417::ENA1 montre un profil d'expression différent par rapport à S. boulardii (expression ectopique x eutopique). Des expériences ultérieures pour comprendre les relations entre l'expression d'Ena1p et l'activation de la H + -ATPase induite par l'acide sont nécessaires pour confirmer cette hypothèse. De plus, d'autres facteurs sont impliqués dans la réponse au stress acide.


Activité H + -ATPase. Activation de la membrane plasmique H + -ATPase dans la nature S. cerevisiae W303 (●), le ena1-4 mutant (■), ena1-4 mutant + p417::ENA1 (◆), ena1-4 mutant + p427::ENA1 (▲), ena1-4 mutant + p417 (◊), et ena1-4 mutant + p427 (
3.4. Augmentation transitoire du Ca 2+ cytosolique induite par l'acide

Le signal calcique induit par le glucose était bien connu et utilisé comme contrôle positif dans la présente expérience [39]. Cependant, les informations sur le signal transitoire du calcium en réponse à l'exposition à l'acide ne sont pas disponibles dans la littérature. Comme prévu, les cellules de levure remises en suspension dans Mes/Tris (0,1 M, pH 6,5) et soumises à des impulsions de glucose ont montré un signal clair de calcium induit par le glucose (Figure 4 (a)). D'un autre côté, les impulsions acides ont produit un très faible signal de calcium cytosolique qui dépendait du pH (figure 4(b)). L'effet d'impulsions acides identiques a également été mesuré dans des suspensions avec une densité cellulaire plus faible. Nous avons observé un signal calcique plus élevé dans ces suspensions, probablement parce que les suspensions cellulaires plus denses avaient une capacité tampon plus élevée (résultats non présentés). Cependant, le test de luminescence est sensible au pH et d'autres études ont démontré une relation entre le pH et la luminescence de la coelenterazine [40]. Pour évaluer si les signaux transitoires de calcium induits par l'acide étaient le résultat de changements de pH, nous avons effectué une expérience similaire en utilisant une impulsion de KCl 15 mM comme contrôle négatif. L'impulsion de KCl n'a pas induit de changement de pH ni stimulé la luminescence (figure 4(b)).


(une)
(b)
(une)
(b) Signalisation du calcium dans S. cerevisiae PAR4741. (a) Signalisation calcique induite par le glucose à pH 6,5 (■), pH 3,7 (▲), pH 3,0 (

), et pH 2,0 (□) (b) signalisation calcique induite par l'acide à pH 5,1 (■), pH 4,2 (▲), pH 3,0 (

La figure 5 montre que la calcineurine et la CrZ1 étaient nécessaires pour induire la réponse au stress acide. Ceci suggère que la calcineurine, une protéine phosphatase, est activée par exposition à l'acide et agit en modulant l'expression des gènes par déphosphorylation du facteur de transcription CrZ1p/Tcn1p et sa translocation vers le noyau [25]. Cette voie a été bloquée par l'ajout de 1 g/mL de FK 506 (inhibiteur de la calcineurine) à une culture de cellules de levure à 0,5 D.O. La condition de stress acide n'a été appliquée que lorsque la concentration cellulaire atteignait 1,0 D.O. Ces cellules (incubées avec FK506) étaient moins résistantes par rapport aux cellules témoins (figure 5). Il est connu que S. cerevisiae génère des signaux calciques cytosoliques en réponse à divers stimuli. Ces signaux transitoires de calcium médient diverses réponses dans les cellules eucaryotes. Par exemple, le stress alcalin déclenche une fluctuation du calcium dans S. cerevisiae [5] et C. albicans [14]. Claret et al. [22] ont proposé l'implication des composants des canaux calciques cellulaires Cch1 et Mid1 dans la viabilité cellulaire à faible pH.


Effet du pH 2,0 (HCl) + 86 mM NaCl sur la calcineurine/crz1 mutants. Les résultats montrent que la réponse au stress acide dépend du métabolisme du calcium et est bloquée par le FK 506.

4. Discussion

Les modifications du pH extracellulaire ont un effet négatif sur le cycle de vie de la levure et le maintien de l'homéostasie du pH interne est important pour la viabilité cellulaire. Les cellules de levure peuvent maintenir un pH interne approprié en utilisant des systèmes de tampon cellulaire et en consommant du H + par des voies métaboliques [41], en augmentant l'extrusion de protons par la membrane plasmique H + -ATPase [42, 43], en transportant l'acide entre le cytosol et les organites [44 , 45]. Nos résultats confirment que le pouvoir tampon cellulaire pourrait faire partie du mécanisme homéostatique du pH impliqué dans la réponse au stress acide. La composition et les niveaux d'acides gras dans la membrane cellulaire ont également été modulés en réponse au stress acide. Ici, nous proposons que la modulation de la composition et du niveau d'acides gras membranaires interfère avec la conductivité H + dans les cellules. Les gènes impliqués dans la biosynthèse des lipides membranaires plasmiques, qui sont des composants structurels essentiels de la membrane, voient leur expression modulée sous stress [46, 47]. La structure de la membrane plasmique est susceptible d'affecter la tolérance des levures à un pH bas et à d'autres stress [47]. Nous avons également montré un effet du sodium sur la modulation de la composition en acides gras après un stress acide (Figure 2). Notre conclusion est en accord avec les observations de Dos Santos Sant'Ana et al. [29], qui ont rapporté que l'ajout de sodium conférait une protection aux cellules de levure contre le stress acide. En fait, l'ajout de sodium a ralenti la dépolarisation favorisée par l'afflux de protons. Les auteurs ont suggéré que, alternativement, l'effet du sodium pourrait être lié à des événements de signalisation inconnus en réponse au stress acide. Par exemple, Bollo et al. [48] ​​ont rapporté un effet de 120 mM de NaCl extracellulaire sur la mobilisation du Ca 2+ à partir des réserves intracellulaires dans Trypanosoma cruzi. Le présent travail a montré que le sodium, par un effet indirect, est capable d'affecter la modulation des acides gras membranaires en condition de stress acide.

Il est bien connu que les cellules de la plupart des organismes maintiennent des rapports de concentration élevés de H + extracellulaire à intracellulaire à travers la membrane plasmique et que les facteurs de stress conduisant à la dissipation du gradient H + à travers la membrane plasmique et à l'acidification intracellulaire induisent la stimulation de la membrane plasmique H + -Activité ATPase. Dans ce travail, nous avons comparé l'activité de la membrane plasmique H + -ATPase dans différentes souches de levure exposées à un pH bas. Les résultats indiquent une activation de la H + -ATPase suite à l'exposition à l'acide. Cependant, le niveau d'activation, comme suggéré précédemment, et la grande tolérance à l'acide dépendaient de l'expression des systèmes de transport secondaires impliqués dans le maintien du potentiel de la membrane plasmique. Cette relation entre l'activation acide de la H + -ATPase et les systèmes secondaires doit être clarifiée par des études de pH interne, de potentiel membranaire et d'activité H + -ATPase dans des souches exprimant différents niveaux d'une famille de gènes, en particulier celles codant pour les transporteurs ioniques les plus importants. .

Dans la levure S. cerevisiae, la calcineurine, une enzyme hétérodimère constituée d'une sous-unité catalytique (a) et d'une sous-unité régulatrice de liaison au calcium (b) associée, est activée dans des conditions environnementales spécifiques et joue un rôle important dans le couplage des signaux Ca 2+ aux réponses cellulaires. La sensibilité et la réponse des cellules à divers stress dépendent de sa capacité à séquestrer et à utiliser le Ca 2+ des réserves externes et internes. Nos résultats montrent que la signalisation calcique participe à la réponse au stress acide et que la réponse au stress est dépendante de la calcineurine. Crz1, une phosphoprotéine substrat pour la calcineurine, fonctionne en aval de la calcineurine pour effectuer des réponses dépendantes de la calcineurine. Les résultats des tests de viabilité montrent des phénotypes similaires pour cnb1Δ et crz1Δ mutants.

La réponse de la levure S. cerevisiae au stress environnemental entraîne un remodelage de l'expression des gènes. Dans des études antérieures, la réponse du génome au stress acide a été évaluée par une analyse de puces à ADN et un criblage fonctionnel réalisé à l'aide d'une collection de délétions de gènes [9, 17]. L'analyse de l'expression a montré que les gènes impliqués dans les réponses au stress, tels que YGP1, TPS1, et HSP150, étaient régulés positivement après un choc acide et que des gènes impliqués dans le métabolisme des métaux ou régulés par Aft1p étaient induits sous l'adaptation acide [17]. La dernière étude a également indiqué que la perte de protéines V-ATPase et Hog-MAPK provoquait une sensibilité aux acides. Les conditions acides légèrement stressantes (par exemple, passage de pH 6 à pH 3) n'affectent pas S. cerevisiae croissance mais peut au contraire être légèrement bénéfique [8]. Cependant, il a été démontré que les protéines de la paroi cellulaire sont régulées à la hausse en réponse à un pH bas [8, 17, 49].

Certaines études sur l'effet du pH acide sur la levure montrent que la voie d'intégrité de la paroi cellulaire PKC est activée en réponse à un pH bas et que RGD1p (voie Hog) joue un rôle en réponse à un pH acide [22-24]. Dans des travaux plus récents, utilisant le criblage de mutants de délétion et le profil d'expression génique, de Lucena et al. [50] ont montré que la voie d'intégrité de la paroi cellulaire est le principal mécanisme de tolérance cellulaire à l'acide sulfurique pH 2,5 et que la voie Ca 2+ -calmoduline est également sensible à ce type de stress. Ici, nous avons montré que les niveaux de calcium libre cytosolique augmentent sous choc acide et que la calcineurine est un transducteur important des signaux calciques dans les réponses au stress acide.

En conclusion, les résultats de la présente étude montrent que la concentration interne en H + de la levure est régulée par plusieurs systèmes, dont la membrane plasmique H + -ATPase, et qu'Ena1p a un rôle important mais non défini dans la réponse cellulaire à l'acide. Nous avons également démontré que la réponse au stress acide dépend du métabolisme du calcium et est bloquée par le FK 506. Études RNA-seq et microarray utilisant différents S. cereviseae souches, y compris S. boulardii, sont actuellement en cours pour donner un aperçu des mécanismes de la réponse au stress acide. En parallèle, des expérimentations visant à caractériser le signal calcique (externe ou interne) et la dépendance de la voie de réponse acide vis-à-vis de la calcineurine/Crz1p sont en cours.

Conflit d'interêts

Les auteurs déclarent qu'il n'y a pas de conflit d'intérêts concernant la publication de cet article.

Remerciements

Ce travail a été soutenu par des subventions de la Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG) (CBB APQ 00333-10/CBB APQ 00482/11) et du Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) à Ieso Miranda Castro ( Processus 304259/2011-0). Júlio César Câmara Rosa et Ana Paula do Carmo ont été soutenus par des bourses de la Coordenação de Aperfeiçoamento de Pessoal do Ensino Superior (CAPES). La langue anglaise de l'article a été révisée par Write Science Right (http://www.writescienceright.com/).

Les références

  1. L. Trabalzini, A. Paffetti, A. Scaloni et al., "Réponse protéomique aux stress physiologiques de fermentation dans une souche de vin de type sauvage de Saccharomyces cerevisiae,” Journal biochimique, vol. 370, non. 1, pp. 35-46, 2003. Voir sur : Site de l'éditeur | Google Scholar
  2. M. Platara, A. Ruiz, R. Serrano, A. Palomino, F. Moreno et J. Ariño, « La réponse transcriptionnelle du gène Na + -ATPase ENA1 de la levure au stress alcalin implique trois voies de signalisation principales » Le Journal de Chimie Biologique, vol. 281, n. 48, pp. 36632-36642, 2006. Voir sur : Site de l'éditeur | Google Scholar
  3. Y. Araki, H. Wu, H. Kitagaki, T. Akao, H. Takagi et H. Shimoi, « Le stress à l'éthanol stimule la voie calcineurine/Crz1 médiée par le Ca 2+ dans Saccharomyces cerevisiae,” Journal des biosciences et de la bio-ingénierie, vol. 107, non. 1, pp. 1–6, 2009. Afficher sur : Site de l'éditeur | Google Scholar
  4. A. Daquinag, M. Fadri, S. Y. Jung, J. Qin et J. Kunz, « Les protéines du domaine PH de la levure Slm1 et Slm2 sont des cibles de la signalisation des sphingolipides pendant la réponse au stress thermique » Biologie moléculaire et cellulaire, vol. 27, non. 2, pp. 633–650, 2007. Afficher sur : Site de l'éditeur | Google Scholar
  5. J. Ariño, « Réponses intégratives au stress à pH élevé dans S. cerevisiae,” OMICS Une revue de biologie intégrative, vol. 14, non. 5, pp. 517-523, 2010. Afficher sur : Site de l'éditeur | Google Scholar
  6. A. P. Gasch, P. T. Spellman, C. M. Kao et al., « Programmes d'expression génomique dans la réponse des cellules de levure aux changements environnementaux » Biologie moléculaire de la cellule, vol. 11, non. 12, pp. 4241–4257, 2000. Voir sur : Google Scholar
  7. H. F. De Melo, B. M. Bonini, J. Thevelein, D. A. Sim&# xf5es et M. A. Morais Jr., « Analyse physiologique et moléculaire de la réponse au stress de Saccharomyces cerevisiae imposée par un acide inorganique fort avec une implication dans les fermentations industrielles » Journal de microbiologie appliquée, vol. 109, non. 1, pp. 116-127, 2010. Afficher sur : Site de l'éditeur | Google Scholar
  8. A.K.-L. Chen, C. Gelling, P. L. Rogers, I. W. Dawes et B. Rosche, « Response of Saccharomyces cerevisiae à une acidification sans stress », Journal de microbiologie, vol. 47, non. 1, pp. 1–8, 2009. Afficher sur : Site de l'éditeur | Google Scholar
  9. H. C. Causton, B. Ren, S. S. K. Sang Seok Koh et al., « Remodelage de l'expression du génome de la levure en réponse aux changements environnementaux » Biologie moléculaire de la cellule, vol. 12, non. 2, pp. 323-337, 2001. Voir sur : Google Scholar
  10. R. Serrano, A. Ruiz, D. Bernal, J. R. Chambers et J. Ari&# xf1o, « La réponse transcriptionnelle au pH alcalin dans Saccharomyces cerevisiae: preuve d'une signalisation médiée par le calcium », Microbiologie moléculaire, vol. 46, non. 5, pp. 1319-1333, 2002. Voir sur : Site de l'éditeur | Google Scholar
  11. R. Serrano, H. Martín, A. Casamayor et J. Ariño, "Signaling alcalin pH stress in the levure Saccharomyces cerevisiae via le capteur de surface cellulaire Wsc1 et la voie Slt2 MAPK », Le Journal de Chimie Biologique, vol. 281, n. 52, pp. 39785–39795, 2006. Voir sur : Site de l'éditeur | Google Scholar
  12. L. Viladevall, R. Serrano, A. Ruiz et al., « Caractérisation de la réponse médiée par le calcium au stress alcalin dans Saccharomyces cerevisiae,” Le Journal de Chimie Biologique, vol. 279, non. 42, pp. 43614–43624, 2004. Voir sur : Site de l'éditeur | Google Scholar
  13. M. Karababa, E. Valentino, G. Pardini, A. T. Coste, J. Bille et D. Sanglard, « CRZ1, une cible de la voie de la calcineurine dans Candida albicans,” Microbiologie moléculaire, vol. 59, non. 5, pp. 1429–1451, 2006. Voir sur : Site de l'éditeur | Google Scholar
  14. H. Wang, Y. Liang, B. Zhang, W. Zheng, L. Xing et M. Li, « Le stress alcalin déclenche une fluctuation immédiate du calcium dans Candida albicans médiée par les facteurs de transcription Rim101p et Crz1p », Recherche sur les levures FEMS, vol. 11, non. 5, pp. 430-439, 2011. Voir sur : Site de l'éditeur | Google Scholar
  15. S. H. Denison, « régulation du pH de l'expression des gènes chez les champignons », Génétique et biologie fongique, vol. 29, non. 2, pp. 61-71, 2000. Voir sur : Site de l'éditeur | Google Scholar
  16. M. A. Pe༚lva, J. Tilburn, E. Bignell et H. N. Arst Jr., « La régulation du gène du pH ambiant chez les champignons : établir des connexions » Tendances en microbiologie, vol. 16, non. 6, pp. 291-300, 2008. Voir sur : Site de l'éditeur | Google Scholar
  17. M. Kawahata, K. Masaki, T. Fujii et H. Iefuji, « Gènes de levure impliqués dans la réponse à l'acide lactique et à l'acide acétique : conditions acides causées par les acides organiques dans Saccharomyces cerevisiae les cultures induisent l'expression de gènes du métabolisme des métaux intracellulaires régulés par Aft1p », Recherche sur les levures FEMS, vol. 6, non. 6, pp. 924-936, 2006. Voir sur : Site de l'éditeur | Google Scholar
  18. P. Piper, C. O. Calderon, K. Hatzixanthis et M. Mollapour, « Adaptation aux acides faibles : la réponse au stress qui confère aux levures une résistance aux conservateurs alimentaires acides organiques » Microbiologie, vol. 147, non. 10, pp. 2635-2642, 2001. Voir sur : Google Scholar
  19. M. G. Cabral, I. Sá-Correia et C. A. Viegas, « Réponses adaptatives chez la levure à l'herbicide acide 2-méthyl-4-chlorophénoxyacétique au niveau de l'homéostasie du pH intracellulaire » Journal de microbiologie appliquée, vol. 96, non. 3, pp. 603-612, 2004. Voir sur : Site de l'éditeur | Google Scholar
  20. M. Mollapour et P. W. Piper, « Délétion ciblée du gène dans Zygosaccharomyces bailii,” Levure, vol. 18, non. 10, pp. 173-186, 2001. Voir sur : Google Scholar
  21. P. Eraso et C. Gancedo, « Activation de l'ATPase de la membrane plasmique de la levure par le pH acide pendant la croissance », Lettres FEBS, vol. 224, non. 1, pp. 187-192, 1987. Voir sur : Google Scholar
  22. S. Claret, X. Gatti, F. Doignon, D. Thoraval et M. Crouzet, « La protéine activatrice Rgd1p Rho GTPase et le capteur de paroi cellulaire Mid2p sont nécessaires à un pH bas pour l'activation de la voie de la protéine kinase C et la survie cellulaire dans Saccharomyces cerevisiae,” Cellule eukaryotique, vol. 4, non. 8, pp. 1375–1386, 2005. Voir sur : Site de l'éditeur | Google Scholar
  23. X. Gatti, G. De Bettignies, S. Claret, F. Doignon, M. Crouzet et D. Thoraval, « RGD1, codant pour un RhoGAP impliqué dans la survie à faible pH, est un gène régulé Msn2p/Msn4p dans Saccharomyces cerevisiae,” Gène, vol. 351, p. 159-169, 2005.Afficher sur : Site de l'éditeur | Google Scholar
  24. H. Fernandes, O. Roumanie, S. Claret et al., « Les petites GTPases Rho3 et Rho4 interagissent fonctionnellement avec Wsc1p, un capteur de surface cellulaire de la voie d'intégrité cellulaire de la protéine kinase C dans Saccharomyces cerevisiae,” Microbiologie, vol. 152, n. 3, pp. 695-708, 2006. Voir sur : Site de l'éditeur | Google Scholar
  25. K. W. Cunningham, « Les réserves de calcium acide de Saccharomyces cerevisiae,” Calcium cellulaire, vol. 50, non. 2, pp. 129-138, 2011. Voir sur : Site de l'éditeur | Google Scholar
  26. T. K. Matsumoto, A. J. Ellsmore, S. G. Cessna et al., « Un transitoire Ca 2+ cytosolique induit par osmotique active la signalisation de la calcineurine pour médier l'homéostasie ionique et la tolérance au sel de Saccharomyces cerevisiae,” Le Journal de Chimie Biologique, vol. 277, non. 36, pp. 33075–33080, 2002. Voir sur : Site de l'éditeur | Google Scholar
  27. M. Bonilla et K. W. Cunningham, « La stimulation par la protéine kinase activée par un agent mitogène de la signalisation Ca 2+ est requise pour la survie du stress du réticulum endoplasmique chez la levure » Biologie moléculaire de la cellule, vol. 14, non. 10, pp. 4296-4305, 2003. Voir sur : Site de l'éditeur | Google Scholar
  28. CV. Popa, I. Dumitru, L. L. Ruta, A. F. Danet et I. C. Farcasanu, « Le stress oxydatif exogène induit la libération de Ca 2+ dans la levure Saccharomyces cerevisiae,” Journal de la FEBS, vol. 277, non. 19, pp. 4027-4038, 2010. Afficher sur : Site de l'éditeur | Google Scholar
  29. G. Dos Santos Sant&# x27Ana, L. Da Silva Paes, A. F. Vieira Paiva et al., « Effet protecteur des ions contre la mort cellulaire induite par le stress acide dans Saccharomyces,” Recherche sur les levures FEMS, vol. 9, non. 5, pp. 701–712, 2009. Afficher sur : Site de l'éditeur | Google Scholar
  30. T. A. Krulwich, R. Agus, M. Schneier et A. A. Guffanti, « Capacité tampon des bacilles qui se développent à différentes plages de pH », Journal de bactériologie, vol. 162, non. 2, pp. 768-772, 1985. Voir sur : Google Scholar
  31. J. Becher Dos Passos, M. Vanhalewyn, R. Lopes Brandao, I. M. Castro, J. R. Nicoli et J. M. Thevelein, « Activation induite par le glucose de la membrane plasmique H + -ATPase chez les mutants de la levure Saccharomyces cerevisiae affecté dans le métabolisme de l'AMPc, la phosphorylation des protéines dépendantes de l'AMPc et l'initiation de la glycolyse », Biochimica et Biophysica Acta : Recherche sur les cellules moléculaires, vol. 1136, n. 1, pp. 57-67, 1992. Voir sur : Site de l'éditeur | Google Scholar
  32. O. H. Lowry, N. J. Rosebrough, A. L. Farr et R. J. Randall, « Mesure des protéines avec le réactif Folin au phénol » Le Journal de Chimie Biologique, vol. 193, non. 1, pp. 265-275, 1951. Voir sur : Google Scholar
  33. R. Tisi, S. Baldassa, F. Belotti et E. Martegani, "La phospholipase C est requise pour l'afflux de calcium induit par le glucose chez la levure en herbe", Lettres FEBS, vol. 520, non. 1𠄳, pp. 133-138, 2002. Voir sur : Site de l'éditeur | Google Scholar
  34. M. C. Pereira, N. M. Vieira, M. R. T&# xf3tola et M. C. M. Kasuya, « Composition totale en acides gras dans la caractérisation et l'identification des champignons mycorhiziens d'orchidées Epulorhiza spp,” Revista Brasileira de Ciencia do Solo, vol. 35, non. 4, pp. 1159-1165, 2011. Voir sur : Google Scholar
  35. C.D. Cruz, Gènes Programa : diversidade gen&# xe9tica [Ph.D. thèse], Universidade Federal de Vi&# xe7osa, Vi&# xe7osa, MG, Brésil, 2008.
  36. J. Sambrook, E. F. Fritsch et T. Maniatis, Clonage moléculaire : un manuel de laboratoire, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, 2e édition, 1989.
  37. H. Ito, Y. Fukuda, K. Murata et A. Kimura, « Transformation de cellules de levure intactes traitées avec des cations alcalins » Journal de bactériologie, vol. 153, non. 1, pp. 163-168, 1983. Voir sur : Google Scholar
  38. A. Ruiz et J. Ariño, « Fonction et régulation du Saccharomyces cerevisiae système ENA sodium ATPase », Cellule eukaryotique, vol. 6, non. 12, pp. 2175-2183, 2007. Afficher sur : Site de l'éditeur | Google Scholar
  39. M. J. M. Tr&# xf3pia, A. S. Cardoso, R. Tisi et al., « Signalisation du calcium et activation induite par le sucre de la membrane plasmique H + -ATPase dans Saccharomyces cerevisiae cellules," Communications de recherche biochimique et biophysique, vol. 343, non. 4, pp. 1234-1243, 2006. Voir sur : Site de l'éditeur | Google Scholar
  40. Y. Zang, Q. Xie, J. B. Robertson et C. H. Johnson, « pHlash : un nouveau capteur de luminescence génétiquement codé et ratiométrique du pH intracellulaire » PLoS UN, vol. 7, numéro d'article 43072, 2012. Voir sur : Google Scholar
  41. M. J. Carlisle, S. C. Watkinson et G. W. Gooday, Les champignons, Academic Press, San Diego, Californie, États-Unis, 2e édition, 2001.
  42. R. Serrano, M. C. Kielland-Brandt et G. R. Fink, « L'ATPase de la membrane plasmique de levure est essentielle à la croissance et présente une homologie avec les (Na + ,K + ), K + et Ca 2+ -ATPases » La nature, vol. 319, non. 6055, pp. 689-693, 1986. Voir sur : Google Scholar
  43. F. Portillo, "Régulation de la membrane plasmique H + -ATPase chez les champignons et les plantes", Biochimica et Biophysica Acta : avis sur les biomembranes, vol. 1469, n. 1, pp. 31-42, 2000. Voir sur : Site de l'éditeur | Google Scholar
  44. V. Carmelo, H. Santos et I. Sá-Correia, « Effet de l'acidification extracellulaire sur l'activité de l'ATPase de la membrane plasmique et sur le pH cytosolique et vacuolaire de Saccharomyces cerevisiae,” Biochimica et Biophysica Acta : Biomembranes, vol. 1325, non. 1, pp. 63-70, 1997. Voir sur : Site de l'éditeur | Google Scholar
  45. G. A. Martínez-Muñoz et P. Kane, « Les pompes à protons vacuolaires et à membrane plasmique collaborent pour atteindre l'homéostasie du pH cytosolique chez la levure » Le Journal de Chimie Biologique, vol. 283, n. 29, pp. 2009–20319, 2008. Voir sur : Site de l'éditeur | Google Scholar
  46. J. Ding, X. Huang, L. Zhang, N. Zhao, D. Yang et K. Zhang, « Tolérance et réponse au stress à l'éthanol dans la levure Saccharomyces cerevisiae,” Microbiologie appliquée et biotechnologie, vol. 85, non. 2, pp. 253-263, 2009. Afficher sur : Site de l'éditeur | Google Scholar
  47. N. P. Mira, M. Palma, J. F. Guerreiro et I. Sá-Correia, « Identification à l'échelle du génome de Saccharomyces cerevisiae gènes nécessaires à la tolérance à l'acide acétique », Usines de cellules microbiennes, vol. 9, article 79, 2010. Afficher sur : Site de l'éditeur | Google Scholar
  48. M. Bollo, S. Bonansea et E. E. Machado, « Implication de l'échangeur Na + /H + dans la signalisation calcique chez les épimastigotes de Trypanosoma cruzi,” Lettres FEBS, vol. 580, non. 11, pp. 2686-2690, 2006. Voir sur : Site de l'éditeur | Google Scholar
  49. J. C. Kapteyn, B. Ter Riet, E. Vink et al., "Un faible ph externe induit des changements dépendants de HOG1 dans l'organisation du Saccharomyces cerevisiae paroi cellulaire," Microbiologie moléculaire, vol. 39, non. 2, pp. 469-479, 2001. Voir sur : Site de l'éditeur | Google Scholar
  50. R. M. de Lucena, C. Elsztein, D. A. Sim&# xf5es, et M. A. Morais Jr, « Participation of CW1, HOG and calcineurine paths in the tolerance of Saccharomyces à un pH bas par l'acide inorganique », Journal de microbiologie appliquée, vol. 113, non. 3, pp. 629-640, 2012. Voir sur : Google Scholar

Droits d'auteur

Copyright © 2014 Marque Rogelio Lopesão et al. Il s'agit d'un article en libre accès distribué sous la licence Creative Commons Attribution, qui permet une utilisation, une distribution et une reproduction sans restriction sur n'importe quel support, à condition que l'œuvre originale soit correctement citée.


INTRODUCTION

Le défi le plus fondamental au niveau du système pour la physiologie cellulaire, en particulier pour les micro-organismes, est la réalisation d'une croissance équilibrée face à un environnement fluctuant. Une variété de processus cellulaires, effectués par des protéines exprimées à partir de milliers de gènes, doivent être coordonnés pour permettre aux cellules de se reproduire, de croître et de rivaliser efficacement pour les ressources. Parmi les processus qui doivent être coordonnés figurent l'extraction d'énergie et de métabolites de l'environnement, la biosynthèse de quantités appropriées de centaines de molécules grandes et petites et les événements du cycle de division cellulaire, y compris la réplication de l'ADN et l'assemblage et la ségrégation des organites subcellulaires. et structures. Toute cette coordination doit se faire de manière à permettre à la cellule de modifier ses activités, souvent à très court terme, lorsque l'environnement change.

L'objectif de comprendre comment les cellules atteignent une croissance équilibrée (ou homéostasie de croissance) a été poursuivi depuis le milieu du 20e siècle, et de nombreux progrès ont été réalisés. Dans les manuels d'aujourd'hui, on peut trouver des comptes rendus cohérents (sinon tout à fait complets) de la régulation métabolique de toutes sortes : régulation de la synthèse macromoléculaire, contrôle du cycle cellulaire, assemblage et distribution des organites, et réponse de ces processus à toutes sortes de perturbations environnementales. et stresse. Cependant, jusqu'à récemment, il n'existait aucun moyen de suivre l'expression de tous les gènes à la fois. Par nécessité, par conséquent, des progrès ont été réalisés en se concentrant sur les rôles des gènes individuels dans chaque processus, souvent par le biais de mutations. Au cours de la dernière décennie, la technologie des puces à ADN a permis des études d'expression génique à l'échelle du génome du cycle cellulaire de la levure (Cho et al., 1998 Spellman et al., 1998 Pramila et al., 2006 Kudlicki et al., 2007) la réponse à divers stress (Gasch et al., 2000 Gasch et al., 2001), et une variété de circonstances métaboliques, telles que le passage diauxique de la croissance sur glucose à la croissance sur éthanol (DeRisi et al., 1997 Brauer et al., 2005) et la croissance à l'état d'équilibre dans une variété de nutriments limitants (Boer et al., 2003 Saldanha et al., 2004 Regenberg et al., 2006 Castrillo et al., 2007). Quelques études récentes (Klevez et al., 2004 ma et al., 2005) ont examiné l'expression des gènes au cours du comportement oscillatoire dans les chémostats, d'où a émergé un lien potentiel avec le contrôle du cycle cellulaire (Futcher, 2006).

Nous avons cherché à explorer, systématiquement et quantitativement, la relation entre le taux de croissance et les modèles d'expression génique à l'échelle du génome dans des cultures de levure à croissance exponentielle et nominalement non stressées. Nous avons spécifiquement cherché à déterminer quels gènes de levure (le cas échéant) sont exprimés à un niveau (mesuré en tant que concentration d'ARNm à l'aide de puces à ADN) simplement corrélé au taux de croissance d'une cellule, indépendamment des facteurs environnementaux qui imposent finalement le taux de croissance instantané observé. En plus de l'expression des gènes, nous avons mesuré la fraction de cellules non bourgeonnées (c'est-à-dire dans les stades G0/G1 du cycle cellulaire) et les concentrations de glucose et d'éthanol dans le milieu.

Comme d'autres études récentes (Regenberg et al., 2006 Castrillo et al., 2007), nous avons exploité le système de culture continue chemostat (Monod, 1950 Novick et Szilard, 1950) pour fournir des conditions stables à différents taux de croissance constants dans une variété de milieux où le nutriment limitant le taux de croissance est connu. Le chemostat permet de contrôler le taux de croissance de l'organisme en ajustant le débit de milieu frais dans la chambre de croissance fournissant un environnement défini propice aux analyses à l'échelle du génome (Hoskisson et Hobbs, 2005).

En analysant les données d'abondance d'ARNm que nous avons obtenues à partir de 36 cultures de chemostat (six nutriments limitants différents chacun à six taux de croissance différents), nous avons constaté qu'une fraction étonnamment importante (∼27%) de tous les gènes de levure est exprimée (tel que mesuré par l'abondance relative d'ARNm) d'une manière étroitement corrélée (soit négativement, soit positivement) avec le taux de croissance de la culture. Nous avons vérifié quantitativement, et étendu aux conditions de culture à l'état d'équilibre, la relation entre le taux de croissance et la fraction de cellules non bourgeonnées suggérée pour la première fois par Unger et Hartwell (1976). Nous avons également découvert une différence frappante entre la limitation de croissance par l'ammonium, le sulfate ou le phosphate ("nutriments naturels" cf. Saldanha et al., 2004) par opposition aux nutriments rendus essentiels par des mutations conférant des besoins auxotrophes. Lorsque la croissance des cultures (à l'état d'équilibre ou par lots) est limitée par le phosphate, l'ammoniac ou le sulfate, le glucose non utilisé est épargné, comme on peut s'y attendre, tandis que lorsque la croissance est limitée par des besoins auxotrophes, l'excès de glucose est complètement consommé.

Nous interprétons ces résultats comme des reflets de mécanismes de régulation au niveau du système, encore partiellement compris, qui doivent sous-tendre la coordination du taux de croissance avec l'expression des gènes, l'entrée dans le cycle de division cellulaire, la réponse au stress et le métabolisme énergétique.


UNE IMAGE DE CONSENSUS DES CONTRLES DU CYCLE CELLULAIRE DANS LA LEVURE EN BOUDING

Activités kinase dépendantes de la cycline

Les événements majeurs du cycle cellulaire chez la levure bourgeonnante sont contrôlés par une seule CDK (Cdc28) en conjonction avec deux familles de cyclines : Cln1–3 et Clb1–6 (Nasmyth, 1993 Mendenhall et Hodge, 1998). Cln1/Cdc28 et Cln2/Cdc28 jouent un rôle majeur dans le bourgeonnement et la duplication du corps polaire du fuseau. Cln3/Cdc28 semble régir la taille à laquelle les cellules nouveau-nées exécutent Start. Clb5/Cdc28 et Clb6/Cdc28 sont essentiels pour la réplication rapide de l'ADN. Clb3/Cdc28 et Clb4/Cdc28 semblent aider à la réplication de l'ADN et à la formation du fuseau. Clb1/Cdc28 et Clb2/Cdc28 sont nécessaires pour la bonne réalisation de la mitose.

Les rôles de ces cyclines se chevauchent. Tous les mutants simples sont viables et presque normaux, sauf cln3 mutants, qui exécutent Start à environ deux fois la taille des cellules de type sauvage (Dirick et al., 1995). (Notation, par exemple, allèle de type sauvage = CLN3, allèle mutant récessif = cln3, allèle mutant dominant = CLN3 D , et produit du gène = Cln3.) Bien que le tripler-cln mutant,cln1 cln2 cln3, est mortel (Richardson et al., 1989), le cln1 cln2 double mutant est grand et viable et capable de bourgeonner. Apparemment, n'importe lequel des Clns peut faire les tâches essentielles des deux autres, si la cellule est suffisamment grande. Le double mutantclb3 clb4 est normal (Richardson et al., 1992Schwob et Nasmyth, 1993), afin que leurs rôles puissent être joués par d'autres Clbs. Parce qu'un clb5 clb6 cellule mutante effectue la synthèse d'ADN (bien qu'avec un certain retard), alors qu'une cellule avec les six CLBgènes supprimés (clb1–6) ne le fait pas, Clb1-4 peut déclencher la synthèse d'ADN en l'absence de Clb5-6 (Schwob et al., 1994). Seule la paire Clb1-2 est spéciale dans le sens où au moins l'une d'entre elles est nécessaire pour compléter la mitose (Surana et al., 1991). Du fait de ces redondances, il suffira de considérer l'interaction de Cdc28 avec seulement quatre classes de cyclines : « Cln2 » (représentant les activités combinées de Cln1 et Cln2), Cln3, « Clb2 » (Clb1 et Clb2 combinés), et « Clb5” (Clb5 et Clb6 combinés). Nous ne gardons pas trace de Clb3-4 dans ce modèle.

Régulation des activités kinase dépendantes de la cycline

Les activités cycline/Cdc28 vont et viennent dans une séquence caractéristique au cours du cycle cellulaire de la levure en herbe. La régulation est réalisée principalement par la synthèse et la dégradation des composants de la cycline et de l'inhibiteur de la kinase dépendante de Clb Sic1. Cln3 est présent à des niveaux faibles et presque constants tout au long du cycle cellulaire Cln2 et son activité kinase associée est maximale au début (Wittenberg et al., 1990 Tyers et al., 1993). Le schéma de Clb5 est similaire à celui de Cln2 (Schwob et Nasmyth, 1993), tandis que Clb2 et son activité kinase associée culminent ∼10 min avant l'anaphase (Suranaet al., 1991). De plus, Sic1 est présent en concentration élevée dans G1 et diminue à de faibles niveaux après le démarrage (Donovanet al., 1994 Schwob et al., 1994).

Dans de nombreux organismes eucaryotes, l'activité Cdk est également contrôlée par la phosphorylation inhibitrice au niveau d'une tyrosine conservée dans l'extrémité N de sa sous-unité kinase. Bien que la levure bourgeonnante possède ce résidu tyrosine (Tyr-19 dans Cdc28) et la kinase et la phosphatase (Swe1 et Mih1) qui régulent la phosphorylation de ce site, la phosphorylation de la tyrosine ne joue pas un rôle important dans la régulation des activités Cdk pendant la croissance végétative normale (Amon et al., 1992 Sorger et Murray, 1992).

Facteurs de transcription

Expression de la CLN2 gène (Koch et al., 1996) est contrôlé par le facteur de transcription SBF (Swi4/Swi6) (Nasmyth et Dirick, 1991), qui peut être activé par les trois kinases associées à Cln et Clb5 (Cross et Tinkelenberg, 1991 Schwob et Nasmyth, 1993) et inactivé par la kinase associée à Clb2 (Amon et al., 1993). Le facteur de transcription MBF (Mbp1/Swi6) pour le NCLC5gène est activé, comme SBF, par les kinases associées à Cln et Clb5 (Koch et al., 1993 Schwob et Nasmyth, 1993) mais inactivé dans G2 par un mécanisme encore inconnu autre que la kinase Clb2/Cdc28 (Amon et al., 1993). Transcription de NCLC2est autocatalytique, car Clb2/Cdc28 active son propre facteur de transcription (Mcm1/SFF) (Amon et al., 1993 Maher et al., 1995). Finalement, SIC1 la transcription, régulée par Swi5, culmine à l'anaphase (Knapp et al., 1996). Swi5 est inactivé par phosphorylation dépendante de Clb2, ce qui l'empêche d'entrer dans le noyau (Nasmyth et al., 1990). Il est activé, d'autre part, par une phosphatase, Cdc14, qui est à son tour activée indirectement par Cdc20 (Visintin et al., 1998Jaspersen et al., 1999), une protéine auxiliaire pour la machinerie de dégradation dépendante de l'APC qui sera décrite dans la section suivante.

Protéolyse

Toutes les cyclines sont dégradées par les protéasomes, qui détruisent les protéines marquées par l'ubiquitine. Le marquage de l'ubiquitine est effectué par une machinerie enzymatique complexe qui active les molécules d'ubiquitine, reconnaît les protéines appropriées à détruire et transfère l'ubiquitine activée à ces protéines condamnées (King et al., 1996 Peters, 1998 Zachariae et Nasmyth, 1999). Pour les cyclines, deux complexes protéiques conjugués à l'ubiquitine sont connus : l'APC et le SCF. L'APC est composée d'une douzaine de protéines, dont Cdc16, -23 et -27, (Zachariae et al., 1996). Le SCF est un complexe de Skp1, Cdc34, Cdc53 et d'une protéine contenant une boîte F, comme Cdc4 ou Grr1 (Jackson, 1996 Krek, 1998). L'APC est responsable de la destruction de Clb2 (Irniger et al., 1995), Clb5 (en partie) (Irniger et Nasmyth, 1997), Cdc20 (Shirayama et al., 1998) et Pds1 (Yamamoto et al., 1996), une protéine qui favorise la cohésion des chromatides sœurs jusqu'à l'anaphase. Le SCF est responsable de la destruction du Cln2 (Deshaies et al., 1995 Willem et al., 1996), Cln3 (Yaglom et al., 1995) et Sic1 (Feldman et al., 1997). Parce que Clb5 est plus stable dansskp1 mutants que dans les cellules de type sauvage (Bai et al., 1996), Clb5 peut être partiellement dégradé par le SCF.

APC et SCF nécessitent des protéines auxiliaires, dont le travail consiste à reconnaître les substrats protéiques appropriés et à les présenter à la machinerie de conjugaison de l'ubiquitine. Par exemple, Cdc4 présente Sic1, et Grr1 présente Cln2 et Cln3 au SCF (Barral et al., 1995Feldman et al., 1997 Li et Johnston, 1997 Skowyraet al., 1997). De la même manière, Hct1 (appelé aussi Cdh1) présente Clb2, et Cdc20 présente Pds1 et Clb5 à l'APC (Schwabet al., 1997 Visintin et al., 1997).

Le SCF semble être actif à tout moment du cycle cellulaire. La dégradation de ses protéines cibles est contrôlée par l'état de phosphorylation de la cible (Willems et al., 1996). Par exemple, en phase G1, Sic1 est non phosphorylé et stable, même si le SCF est actif. Lorsque l'activité de la kinase associée à Cln2 augmente au démarrage, Sic1 est phosphorylée et Sic1P est rapidement présentée par Cdc4 au SCF pour l'ubiquitination et la protéolyse ultérieure (Verma et al., 1997). De même, Cln2 doit être phosphorylé avant d'être reconnu par Grr1 (Barral et al., 1995 Li et Johnston, 1997).

La protéolyse dépendante de l'APC, d'autre part, est contrôlée par la phosphorylation de la machinerie d'ubiquitination elle-même, plutôt que par les protéines cibles. Il existe des preuves dans l'extrait d'ovocyte de palourde (Lahav-Baratzet al., 1995 Soudan et al., 1995),Xénope extrait d'oeuf (Félix et al., 1990 Peterset al., 1996) et des cellules de mammifères (Kotani et al., 1998) que le noyau APC est activé par phosphorylation et que les CDK peuvent être impliquées dans cette activation indirectement via une kinase de type polo (dont l'homologue dans la levure bourgeonnante est Cdc5) (Descombes et Nigg, 1998 Kotani et al., 1998). Mais de tels effets ne sont pas encore bien établis chez la levure bourgeonnante, nous n'essayons donc pas de les modéliser dans le présent article.

Nous nous concentrons plutôt sur les protéines auxiliaires, qui semblent exister sous des formes actives et inactives. Pour la machinerie de dégradation dépendante de Hct1, Amon (1997) a montré que, in vivo, la protéolyse des cyclines peut être désactivée par l'expression ectopique de Clb2 (et réactivée par l'expression de Sic1). Des expériences récentes (Zachariae et al., 1998 Jaspersen et al., 1999) montrent que, in vitro, les CDK peuvent phosphoryler Hct1, le rendant incapable d'interagir avec le noyau APC. Ensemble, ces résultats confirment l'hypothèse de Nasmyth (1996) selon laquelle l'activité CDK et la protéolyse Clb sont des événements antagonistes : CDK inactive l'APC par phosphorylation, tandis que l'APC détruit l'activité CDK par dégradation des composants cyclines. La phosphatase qui s'oppose à CDK (et active ainsi Hct1) est Cdc14. A noter que le couple kinase-phosphatase, CDK-Cdc14, régule non seulement l'activité de Hct1 mais aussi la synthèse (Swi5) et la dégradation (état de phosphorylation) de Sic1 (Visintin et al., 1998 Jaspersen et al., 1999).

La machinerie de dégradation dépendante de Cdc20 est encore plus compliquée. Lorsque les cellules sortent de la mitose, elle est responsable de la dégradation de Pds1, qui limite la dissociation des cohésines en se liant à et en inhibant Esp1, une protéine essentielle à la séparation des chromatides sœurs (Ciosk et al., 1998). Cdc20 est également responsable de la perte d'un inhibiteur de Cdc14 (Novak et al., 1999), conduisant à l'activation de Hct1 et Swi5 (Visintin et al., 1997 Lim et al., 1998 Shirayama et al., 1998). Le complexe RENT, récemment identifié par Shou et al. (1999) et Visintin et al. (1999), peut inhiber le Cdc14 par séquestration réversible.

Point de contrôle mitotique

Il a été montré (Hwang et al., 1998) que Cdc20 est une cible probable pour les signaux provenant de chromosomes non alignés, d'ADN non répliqué et d'ADN endommagé, qui maintiennent tous Cdc20 sous sa forme inactive. L'ADN non répliqué, en plus de maintenir le Cdc20 inactif, semble également empiéter sur la voie d'activation de l'APC (Hwang et al., 1998 Kotani et al., 1998). Le résultat final est que, lorsque la réplication de l'ADN est terminée et que tous les chromosomes sont en tension sur la plaque métaphasique, l'APC est phosphorylée et Cdc20 est activé, conduisant à la dégradation de Pds1 (d'où, dissolution des cohésions) et à l'activation de Hct1 (d'où , destruction de Clb2).


Discussion

Ici, nous avons analysé les interactions génétiques entre les mutations dans les gènes codant pour les sous-unités de l'OST et les allèles nuls de la SCJ1 et JEM1 gènes codant pour des homologues du chaperon bactérien DnaJ. Nous avons observé que le stress de repliement des protéines induit par l'hypoglycosylation provoque un défaut de croissance synthétique dans les cellules qui n'expriment pas Scj1p. Les cellules dépourvues à la fois de Scj1p et de Jem1p sont extrêmement sensibles à l'hypoglycosylation. Nos données fournissent la première preuve directe que Scj1p et Jem1p jouent un rôle dans le repliement des protéines dans la lumière du RE de la levure.

Un aperçu du rôle de Scj1p en tant que cofacteur régulateur pour Kar2p dans la lumière du RE est fourni en considérant le cycle de réaction dépendant de l'hydrolyse de l'ATP de leurs homologues procaryotes DnaJ et DnaK. L'affinité du domaine de liaison peptidique de DnaK pour les polypeptides substrats est contrôlée par le cycle ATPase de DnaK, qui est à son tour régulé par DnaJ et GrpE qui stimulent respectivement l'hydrolyse de l'ATP et l'échange de ribonucléotides (pour des revues récentes, voir Hartl, 1996 Bukau et Horwich , 1998). La conformation liée à l'ATP de DnaK se lie et libère rapidement les substrats polypeptidiques, tandis que la conformation liée à l'ADP de DnaK se lie aux peptides avec une affinité plus élevée en raison d'un taux réduit de dissociation des peptides. Il a été démontré que les homologues eucaryotes de l'ADNJ stimulent l'activité ATPase intrinsèque des protéines Hsp70 (Cyr et al., 1992 Braun et al., 1996 Schumacker et al., 1996), il est donc probable que Scj1p stimule l'activité ATPase de Kar2p. DnaJ est capable de lier des polypeptides dépliés et de délivrer ces substrats à la conformation liée à l'ATP de DnaK (Szabo et al., 1994). Le domaine de liaison au substrat de DnaJ a été mappé à un domaine de type doigt de zinc qui est conservé dans de nombreux homologues eucaryotes (Scj1p, Mdj1p et Ydj1p), mais pas tous (Sec63p et Jem1p) (Szabo et al., 1996). La présence dans Scj1p du domaine de type doigt de zinc riche en cystéine soutient fortement que Scj1p reconnaît les polypeptides dépliés dans la lumière du RE et initie des réactions de repliement par coopération avec Kar2p. Après hydrolyse de l'ATP et dissociation médiée par GrpE de l'ADP, le polypeptide substrat se dissocie de DnaK et procède le long d'une voie de repliement ou est plutôt rebondi par DnaJ pour une autre interaction cyclique avec DnaK

Interactions génétiques entre les mutants OST et les mutants ER chaperon

Les ost1-6 allèle qui a été identifié dans le criblage de létalité synthétique est phénotypiquement similaire à d'autres précédemment décrits ost1 mutants (Silberstein et al., 1995). La mutation dans Ost1p confère un phénotype de croissance sensible à la température même si les glycoprotéines naissantes sont hypoglycosylées aux températures permissives et restrictives. Comme indiqué précédemment pour d'autres ost1 mutants (Silberstein et al., 1995), l'expression de Kar2p est induite dans ost1-6 cellules à la température permissive (Silberstein, S. et R. Gilmore, observation non publiée). Compte tenu du rôle des oligosaccharides liés à l'azote dans le repliement des protéines, une interaction génétique synthétique est prévue pour les souches de levure qui présentent des défauts dans une sous-unité OST et la protéine Kar2. En effet, un phénotype de croissance lente est observé dans chaque cas pour les souches doubles mutantes qui combinent une wbp1 mutation (wbp1-1 ou wbp1-2) avec un kar2 mutation (kar2-1, kar-159, ou kar2-203 te Heesen et Aebi, 1994). Ici, nous avons observé un phénotype létal synthétique pour le ost1-6kar2-159 double mutant.

Le défaut de glycosylation causé par ost1-6 ne compromet pas gravement la croissance de la souche mutante à 25°C. Cependant, la perte de Scj1p n'a pas été tolérée dans un ost1-6 fond à n'importe quelle température. Contrairement au kar2 des mutants défectueux dans plusieurs voies associées au RER, scj1 les mutants n'ont pas de défauts précédemment rapportés dans la translocation des protéines, la fusion de la membrane nucléaire pendant la caryogamie, le repliement des protéines ou la résistance à un choc thermique sévère. Par conséquent, plusieurs explications différentes ont été envisagées pour expliquer l'inviabilité de la scj1ost1-6 mutant. La découverte que le scj1ost1-6 mutant est viable sur des plaques qui contiennent un agent stabilisant osmotique plaide fortement contre la perte catastrophique de complexes OST entièrement assemblés dans le scj1ost1-6 mutant. Comme scj1 les mutants sont de type sauvage en ce qui concerne la glycosylation N-liée des protéines, le phénotype létal du double mutant ne peut pas être facilement expliqué par l'effet additif de deux lésions dans l'addition d'oligosaccharides. Des interactions létales synthétiques de ce dernier type se produisent lorsqu'un mutant OST (par exemple, wbp1-2) est associé à un alg (glycosylation liée à l'asparagine) mutant qui bloque l'assemblage du donneur d'oligosaccharide lié au dolichol de taille normale pour la glycosylation (Stagljar et al., 1994).

Pour étudier l'effet de la suppression de Scj1p dans une souche viable présentant des défauts de N-glycosylation, nous avons construit le Δost3Δscj1 mutant. Les Δost3Δscj1 le mutant présente un défaut de croissance synthétique, sans montrer une réduction concomitante de la N-glycosylation des protéines, indiquant que Scj1p n'a pas d'effet direct ou indirect sur l'efficacité de la réaction de glycosylation. Le phénotype plus restrictif de la scj1ost1-6 parent mutant du Δost3Δscj1 mutant suggère que le besoin de Scj1p augmente à mesure que la sévérité de l'hypoglycosylation augmente.

Un rôle pour Scj1p dans le repliement des protéines

Pour de nombreuses protéines qui entrent dans la voie de sécrétion, l'ajout d'oligosaccharides N-liés est une modification importante qui précède l'acquisition réussie de la structure tertiaire. Jusqu'à ce que les protéines se replient, elles ne sont pas emballées dans des vésicules pour le transport intracellulaire, mais sont plutôt retenues dans le réticulum endoplasmique. Ici, nous avons observé que le taux d'exportation d'ER pour une forme mutante de CPY dépourvue d'oligosaccharides liés à N était réduit de deux fois dans les cellules dépourvues de Scj1p. Le taux de transport réduit pour le CPY non glycosylé était en contraste marqué avec le taux de transport de type sauvage pour le CPY entièrement glycosylé dans les cellules dépourvues de Scj1p. Les protéines déficientes en repliement sont retenues dans le RE via des interactions prolongées avec le chaperon Hsp70 BiP ou Kar2p (De Silva et al., 1990). La lente maturation du CPY non glycosylé, mais pas du CPY entièrement glycosylé, a été précédemment observée chez kar2 mutants (te Heesen et Aebi, 1994). Le précurseur non glycosylé (pug-CPY) s'est avéré être présent dans un complexe avec des protéines mutantes Kar2p qui présentaient des lésions dans le domaine ATPase (c'est-à-dire, kar2-159 et kar2-203 te Heesen et Aebi, 1994). Ici, nous avons observé une association prolongée entre Kar2p et le CPY non glycosylé dans le réticulum endoplasmique. Nos résultats indiquent qu'en plus de Kar2p, un repliement efficace de CPY non glycosylé nécessite l'homologue DnaJ Scj1p. Le destin principal des protéines solubles qui ne se replient pas dans le RER de levure est la dislocation vers le cytosol pour une dégradation ultérieure par le protéasome (Hiller et al., 1996). Comme indiqué précédemment, la voie de dégradation ne semble pas être empruntée par le carlin-CPY dans les cellules de type sauvage (Winther et al., 1991). Ici, nous n'avons pas observé de perte sélective de carlin-CPY au cours de l'incubation de chasse d'une heure dans des souches mutantes dépourvues de Scj1p ou de Jem1p. Un essai in vitro de la dégradation induite par le protéasome du facteur pro-α non glycosylé n'a pas révélé de rôle important pour Scj1p dans la dégradation de ce substrat (McCracken et Brodsky, 1996).

Le transport retardé des protéines hypoglycosylées avec altération du repliement vers la paroi cellulaire fournit l'explication la plus probable des phénotypes synthétiques qui surviennent lorsque scj1 est associé à des mutations de l'OST. Cette dernière conclusion est étayée par l'observation que scj1 les cellules sont hypersensibles à la tunicamycine. En l'absence de mutation OST, scj1 les mutants n'ont pas de défaut évident de la paroi cellulaire. Cependant, le défaut de la paroi cellulaire du ost3 mutant a été grandement exagéré dans une souche de levure dépourvue de Scj1p. Il a été constaté que le pliage du CPY réduit par la TNT nécessite Kar2p, car les souches portant kar2 allèles avec des mutations qui se mappent dans le domaine ATPase (par exemple, kar2-159) sont incapables de former des liaisons disulfure natives dans p1CPY après élimination du DTT, ce qui entraîne la formation d'agrégats de masse moléculaire élevée de Kar2p et de p1CPY déplié (Simons et al., 1995). Nous n'avons pas obtenu de preuves que Scj1p était nécessaire pour la maturation du CPY après un stress redox, ce qui suggère que le CPY réduit par le DTT peut exister en tant qu'intermédiaire de repliement compact qui acquiert rapidement une conformation native après l'élimination du réducteur sans intervention de Scj1p. Cependant, le CPY non glycosylé ne s'est pas replié correctement dans le scj1Δjem1 mutant après un stress redox, mais a plutôt été retenu dans le réticulum endoplasmique. Fait intéressant, nous avons observé que Δost3Δscj1 les cellules sont hypersensibles au DTT, ce qui suggère que Scj1p n'agit pas exclusivement pendant le repliement des glycoprotéines, mais joue plutôt un rôle plus large dans la maturation des protéines altérées par le repliement dans le RER.

Survie de levure sans Scj1p

Comment résoudre le paradoxe apparent entre le statut non essentiel du SCJ1 et le rôle postulé de Scj1p en tant que cofacteur régulateur de la protéine essentielle Kar2 lors du repliement des protéines dans la lumière du RE. La voie UPR induit une expression accrue des chaperons RER et des enzymes de repliement des protéines pour permettre la survie dans des conditions qui interfèrent avec le repliement des protéines dans le RER. Fait intéressant, la voie UPR est indispensable pour la viabilité cellulaire dans des conditions de croissance normales (Cox et al., 1993). Une explication possible de la nature non essentielle de Scj1p serait que Scj1p n'agit que comme chaperon lorsque les protéines dépliées s'accumulent dans le RER. Cependant, nous avons constaté que les souches dépourvues de Scj1p expriment des niveaux élevés de Kar2p et Jem1p en l'absence d'autres perturbateurs, indiquant que la perte de Scj1p provoque un stress de repliement des protéines dans le RER. Nous proposons que Scj1p soit le cochaperon principal de Kar2p dans les réactions de repliement des protéines dans des conditions physiologiques normales.

Une deuxième explication de la nature non essentielle de Scj1p est suggérée par la présence d'un homologue essentiel et de deux homologues non essentiels de DnaJ dans le même compartiment cellulaire, ce qui soulève la possibilité que ces protéines remplissent des fonctions partiellement redondantes. Une redondance fonctionnelle complète de Scj1p, Sec63p et Jem1p peut être écartée pour plusieurs raisons. Des trois homologues de DnaJ, seul Sec63p a la localisation correcte en tant que composant du grand complexe Sec (Deshaies et al., 1991 Panzner et al., 1995) pour recruter Kar2p dans le canal de translocation protéique pour interagir avec les substrats de translocation (Brodsky et Schekman, 1993 Corsi et Schekman, 1997). Avant ce rapport, un chevauchement partiel de fonction pour Scj1p et Jem1p a été suggéré par le phénotype de croissance sensible à la température du Δscj1Δjem1 mutant et par l'observation que l'expression des deux protéines est contrôlée par la voie UPR (Schlenstedt et al., 1995 Nishikawa et Endo, 1997).

Le phénotype de croissance de type sauvage de la scj1 mutant s'explique le plus facilement par l'induction de la voie UPR conduisant à une expression améliorée des chaperons RER, notamment Kar2p, Lhs1p et Jem1p. Kar2p se lie aux polypeptides naissants lorsqu'ils pénètrent dans la lumière du RE via le canal Sec61 (Sanders et al., 1992), donc l'interaction initiale entre une protéine dépliée et Kar2p est médiée par Sec63p (Corsi et Schekman, 1997). Pour les protéines de type sauvage qui se replient rapidement, cette interaction initiale indépendante de Scj1p entre Kar2p et les segments hydrophobes du polypeptide naissant peut être suffisante pour initier un repliement productif dans la lumière RER. En l'absence de mutations ou de perturbateurs qui interfèrent avec le repliement des protéines dans le RER, une expression accrue de Kar2p et Jem1p peut compenser la perte de Scj1p. En théorie, une concentration luminale plus élevée de Kar2p peut entraîner une liaison indépendante de Scj1p de Kar2p aux protéines se repliant lentement dans la lumière RER. De plus, la suppression du phénotype de croissance sensible à la température de la Δost3Δscj1 souche par la copie haute JEM1 plasmide soutient fermement que l'induction de l'expression de Jem1p médiée par UPR aidera à compenser la perte de Scj1p.

Chevauchement, mais rôles non identiques pour Jem1p et Scj1p

L'induction de l'expression de Kar2p était plus importante dans le scj1 mutant que dans le jem1 mutant. Conformément à la réduction relativement mineure du taux de croissance à 37 °C pour le Δost3Δjem1 mutant, nous avons observé que jem1 les cellules de levure ne sont pas hypersensibles à la tunicamycine et sont capables de transporter le CPY non glycosylé vers la vacuole à une vitesse de type sauvage. Nous concluons que la viabilité de scj1 les cellules ne peuvent pas être expliquées de manière adéquate par une redondance complète de Scj1p et Jem1p. Néanmoins, plusieurs observations rapportées ici suggèrent un rôle pour Jem1p dans le repliement des protéines dans le RER. En comparaison avec le jem1 mutant, le scj1Δjem1 le double mutant montre une élévation supplémentaire de l'expression de Kar2p et un retard plus important dans le transport de l'ug-CPY vers la vacuole. De plus, l'expression d'une protéine altérée par le repliement (c'est-à-dire ug-CPY) dans le scj1Δjem1 le double mutant interfère avec la sortie du RE du CPY de type sauvage entièrement glycosylé, ce qui suggère que la capacité de repliement des protéines du RE a été dépassée. Étonnamment, l'expression de Jem1p à partir d'un vecteur de copie élevé atténue largement le défaut de croissance sensible à la température du scj1Δost3 mutant. La surexpression de Jem1p peut être en mesure de compenser la perte de Scj1p, même si Jem1p ne possède pas le domaine riche en cystéine qui a été impliqué dans la reconnaissance du substrat. Ces données, ainsi que l'inviabilité d'un ost3Δscj1 jem1 souche, sont compatibles avec Jem1p agissant comme un deuxième chaperon régulateur pour le repliement protéique médié par Kar2p dans le RER. Bien que Jem1p ait été initialement considérée comme une protéine membranaire intégrale de type II (Nishikawa et Endo, 1997), une étude plus récente a établi que le codon d'initiation de Jem1p était incorrectement attribué et que Jem1p est une protéine membranaire périphérique associée à la face luminale. de la levure RER (Nishikawa et Endo, 1998). En théorie, le rôle principal de Jem1p en tant que chaperon pourrait être de recruter Kar2p (ou Lhs1p) dans la membrane pour interagir avec les protéines membranaires dépliées. Par conséquent, un substrat soluble comme la proCPY non glycosylée peut ne pas être le substrat optimal pour révéler un retard de repliement causé par la perte de Jem1p.


DISCUSSION

Les réactions de transfert à un carbone médiées par des cofacteurs de folate jouent un rôle essentiel dans une variété de réactions cellulaires. Semblable aux bactéries et aux plantes S. cerevisiae produit du folate de novo à partir de la ptérine, p-aminobenzoate et des fragments glutamate. La voie de synthèse du folate de levure n'est pas complètement comprise. Dans ce travail, nous avons montré que la S. cerevisiae FOL1 gène code pour les activités enzymatiques essentielles DHNA, HPPK et DHPS, qui effectuent trois étapes ultérieures dans la biosynthèse du folate. Nos données suggèrent que la biosynthèse du transporteur C1 semble être réalisée au niveau des mitochondries car Fol1p est localisé dans le système membranaire mitochondrial. Fait intéressant, la suppression de FOL1 donne lieu à une induction de filamentation et de croissance adhésive sur des milieux supplémentés en acide folinique en présence de quantités excessives de glucose et d'ammonium, qui sont des suppresseurs connus du commutateur dimorphique. Croissance invasive induite dans fol1Δ dépend du facteur de transcription MAP kinase Ste12p ainsi que de l'adhésine principale Flo11p. En effet, les niveaux d'expression de Flo11p sont augmentés de manière dépendante de Ste12p dans les souches où FOL1 est absent. Fait intéressant, cependant, la croissance filamenteuse observée dans fol1Δ ne dépend pas des facteurs de transcription Ste12p, Tec1p et Phd1p ni de Flo11p, ce qui suggère que dans fol1Δ souches encore des mécanismes/voies/adhésines inconnus sont nécessaires pour la croissance des pseudohyphes.

La nature trifonctionnelle de Fol1p est conservée dans l'évolution

Les trois activités enzymatiques différentes réalisées par Fol1p ont été trouvées chez la plupart des procaryotes, des eucaryotes microbiens et des plantes, mais sont absentes chez les mammifères (figure 2). Dans la plupart des bactéries, les trois activités enzymatiques sont codées par trois ORF distincts ( Slock et al., 1990 Dallas et al., 1992 Talarico et al., 1992 Jardine et al., 2002 ). Cependant, chez certains procaryotes, les activités enzymatiques HPPK et DHNA sont liées en tant que protéine bifonctionnelle, alors que la DHPS est codée par un ORF séparé (Lopez et Lacks, 1993). Chez les bactéries, les gènes codant pour des enzymes consécutives d'une voie de biosynthèse sont souvent adjacents ou proches les uns des autres sur le chromosome, ce qui suggère qu'ils sont corégulés d'une manière ou d'une autre (Jardine et al., 2002 ).

Chez les eucaryotes, l'analyse biochimique des gènes de biosynthèse des folates caractérisés jusqu'à présent a révélé que les protéines correspondantes sont toujours multifonctionnelles, contenant des activités HPPK et DHPS fusionnées (Allegra et al., 1990 Triglia et Cowman, 1994 Rebeille et al., 1997 ) et fusionner les activités DHNA, HPPK et DHPS (Volpe et al., 1992 , 1995 ce travail). De plus dans les levures S. pombe et C. albicans Il existe des ORF qui pourraient coder pour une protéine présentant une homologie avec les trois activités enzymatiques (figure 2). Cependant, dans d'autres champignons comme N. crassa ou dans le champignon phytopathogène Magnaporthe grisea, la protéine bifonctionnelle HPPK/DHPS semble être séparée de l'activité DHNA. La nature multifonctionnelle de cette protéine semble être courante chez les espèces fongiques et végétales, cependant, seul un sous-ensemble de champignons contient la structure trifonctionnelle. Il n'est pas clair si les autres champignons et les plantes ont déplacé le troisième gène parce que les événements de fusion initiaux se sont produits ou si la fusion trifonctionnelle s'est produite plus tard dans l'évolution dans seulement un sous-ensemble d'espèces fongiques. Que les activités enzymatiques proviennent d'un ou de plusieurs gènes affecte à la fois la régulation de l'expression des gènes et la localisation des enzymes (Figure 2).

Très récemment, les enzymes biosynthétiques de l'acide folique ont été utilisées pour l'enracinement de l'arbre eucaryote. Stechmann et Cavalier-Smith (2002) ont utilisé une fusion de gènes dérivés entre la dihydrofolate réductase et la thymidylate synthase afin de localiser la racine de l'arbre eucaryote entre les bikontes et les opisthokontes. Cependant, la position de l'Amoebozoa doit être clarifiée avant que la racine puisse être localisée avec précision. Ainsi, l'analyse de la biosynthèse de l'acide folique et en particulier des activités DHNA, HPPK et DHPS chez les Amoebozoa pourrait initier d'autres études concernant l'identification de lignées eucaryotes à ramification précoce.

Fol1p est essentiel pour la croissance

Nos données montrent que la FOL1 gène est essentiel à la S. cerevisiae cycle de vie végétatif, et fol1Les souches Δ ne peuvent être maintenues en vie que par l'ajout d'acide folinique. Cela a également été démontré pour une délétion partielle de la partie C-terminale de la FOL1 gène codant pour l'activité DHPS ( Bayly et al., 2001 ). Des résultats similaires ont été obtenus pour FOL2 (codant pour la GTP-cyclohydrolase I) et FOL3 (codant pour la dihydrofolate synthétase Nardese et al., 1996 Cherest et al., 2000 ). L'acide folinique est un dérivé du folate, qui complète le pool de porteurs C1 sur un site distinct du DHF ( Holmes et Appling, 2002 ). Nous n'avons pas testé si la supplémentation en fol1Δ les souches contenant de l'acide folique restaurent également la croissance, comme indiqué pour d'autres souches sans folate (Cherest et al., 2000 Bayly et al., 2001 Bayly et Macreadie, 2002 ). Que le pool de folates intracellulaires était en effet limitant pour la croissance a été démontré par le fait que le taux de croissance de la fol1La souche Δ dépendait de la quantité d'acide folinique extracellulaire ajoutée bien qu'une croissance de type poids n'ait jamais pu être observée (figure 3, données non publiées). De plus, le fait que des quantités élevées d'acide folinique soient nécessaires indique que la cellule de levure ne possède probablement pas de système de transport d'absorption actif pour les dérivés d'acide folique.

Le phénotype terminal d'un FOL1 la délétion est une microcolonie de cellules légèrement allongées � indiquant que le pool de folate dans la spore dérivé d'une souche de délétion diploïde hétérozygote est suffisant pour le processus de sporulation et les 5 premières divisions cellulaires subséquentes. Cette très faible demande en folate s'explique par le fait qu'un seul support carboné est réutilisé et non consommé. Parce qu'il n'y a pas de consommation de dérivés folate, on peut supposer que FOL1 l'expression des gènes est faible. En effet la quantification de la FOL1 transcription ainsi que la nôtre FOL1 des études sur les promoteurs (données non publiées) ont révélé un très faible taux d'ARNm (Planta et al., 1999 ). De plus, l'expression de Fol1p est régulée comme dans les souches wt cultivées en présence d'acide folinique extracellulaire. FOL1 le promoteur est réprimé (voir la figure 4C). De plus, le glucose active l'expression de Fol1p, tandis que la phase stationnaire entraîne la répression de l'expression de Fol1p (Planta et al., 1999 ). Ces données indiquent une régulation complexe de FOL1 l'expression des gènes, suggérant que le niveau de protéine Fol1 est ajusté de manière adéquate à la situation nutritionnelle de la cellule de levure.

Surexpression très forte de FOL1 est toxique pour les levures (figure 4A) et les bactéries (données non publiées). Récemment, une relation inverse a été rapportée entre FOL1 les niveaux d'expression et le taux de croissance des souches de levure correspondantes ( Iliades et al., 2003 ). Augmenté FOL1 l'expression pourrait entraîner la production de quantités excessives de 7,8-dihydroptéroate épuise le pool de GTP, qui est également nécessaire pour d'autres voies de biosynthèse ou parce que la surproduction de ces intermédiaires folate inhibe les enzymes folate-dépendantes similaires à l'action de l'acide folinique ( Girgis et al., 1997 ). Alternativement, la croissance de FOL1 la surexpression des souches pourrait être entravée car des niveaux accrus de 7,8-dihydroptéroate sont toxiques pour les cellules de levure ( Bayly et Macreadie, 2002 ).

Fol1p est localisé dans le système membranaire mitochondrial

La localisation in vivo d'une protéine de fusion Fol1 a montré un schéma similaire à celui observé pour les mitochondries (Figure 5). La microcopie électronique a confirmé la localisation mitochondriale d'une protéine de fusion GFP-Fol1, car les membranes mitochondriales étaient marquées presque exclusivement par les particules d'or. Cependant, parce que la surexpression de GFP-Fol1p a donné lieu à des mitochondries agglutinées, nous n'avons pas pu faire de distinction entre la localisation membranaire interne et externe. La localisation de Fol1p a également été analysée par des études EM utilisant des anticorps anti-peptide Fol1p et à nouveau une coloration prédominante au niveau des membranes mitochondriales a été observée (Figure 6d).

Quelles sont les implications de la localisation associée à la membrane mitochondriale de Fol1p en tant que composant multifonctionnel central de la machinerie de biosynthèse du folate pour la production de folate dans S. cerevisiae? Dans la levure, le cytosol et les mitochondries contiennent tous deux des coenzymes de folate et les deux compartiments possèdent un réseau parallèle d'enzymes catalysant l'interconversion des unités de folate dans différents états d'oxydation (Appling, 1991 McNeil et al., 1996 ). Sur la base de nos données, on pourrait maintenant supposer que dans la levure, la biosynthèse du folate est associée aux mitochondries et que le 7,8-dihydroptéroate (pas de résidu γ-glutamate) et/ou DHF/THF (1 γ-glutamate résidu voir Figure 1) sont transportés dans la matrice mitochondriale et dans le cytosol où leur conversion en dérivés oligo-γ-glutamyl physiologiquement pertinents pourrait se produire. Récemment, il a été rapporté que l'activité cytosolique ainsi que mitochondriale de la folylpolyglutamate synthétase est codée par MET7 (Chérest et al., 2000 DeSouza et al., 2000 ).

En plus de FOL1 étant essentiel pour la biosynthèse du folate, nous avons constaté que la perte de FOL1 altère la croissance sur les sources de carbone non fermentescibles (données non publiées). De même, il a été constaté que la perte de l'activité de la dihydrofolate réductase (DHFR) entraîne également l'incapacité du mutant de levure à se développer sur le glycérol ( Huang et al., 1992 ). Ces données suggèrent que les porteurs C1 directement ou indirectement sont essentiels pour la fonction mitochondriale.

L'épuisement des coezymes folates induit la croissance des pseudohyphes et l'invasion de la gélose

Les données présentées ici démontrent que la croissance des haploïdes fol1Les cellules Δ sur un milieu additionné d'acide folinique entraînent une croissance filamenteuse et la capacité d'adhérer à la gélose. Le phénotype à croissance lente d'un fol1La souche mutante Δ, même en présence de quantités élevées d'acide folinique, suggère que la famine des cellules pour les unités porteuses C1 induit le changement dimorphique. Fait intéressant à la fois la croissance filamenteuse et la capacité de la fol1Δ cellules à adhérer au substrat de gélose est induite en présence de glucose et d'ammonium élevés. Ainsi, nos données indiquent que la famine pour le transporteur C1 est un autre signal nutritionnel qui active la croissance filamenteuse et adhésive.

Pour tester si le phénotype de croissance haploïde invasif et pseudohyphe dépendait de la voie MAP kinase et de l'adhésine majeure Flo11p, nous avons construit fol1Δ ste12Δ, fol1Δ tec1Δ, et fol1Δ flo11Δ souches à double délétion. Ste12p est le facteur de transcription à la fin de la cascade MAP kinase, qui, avec Tec1p, se lie aux FRE (éléments de réponse de filamentation et d'invasion) dans les promoteurs de gènes, qui sont impliqués dans le changement dimorphique ( Madhani et Fink, 1998b ). Un tel élément FRE est situé dans le promoteur du gène codant pour la flocculline de surface cellulaire FLO11, qui est nécessaire à la formation et à l'invasion des pseudohyphes ( Lo et Dranginis, 1998 ). Les FLO11 le promoteur intègre la cascade de MAP kinase et les voies de signalisation de la filamentation cAMP/PKA ( Pan et Heitman, 1999 Rupp et al., 1999 ). Le phénotype d'adhérence sur gélose observé pour fol1Les cellules Δ dépendent du facteur de transcription Ste12p spécifique de MAPK et de la protéine de paroi cellulaire Flo11p mais pas du facteur de transcription Tec1p. Étonnamment le fol1Δ ste12Δ, fol1Δ tec1Δ, et fol1Δ flo11Δ les souches à double délétion ont montré le même degré de croissance filamenteuse que les souches fol1Δ suppression unique (Figure 8). Cela suggère que le signal de famine interne créé par le fol1 la délétion induit une croissance filamenteuse indépendante de Ste12p et Tec1p. Conformément à ce résultat, nous n'avons pas non plus pu détecter une augmentation du niveau de phosphorylation des MAP kinases Kss1p et Fus3p, suggérant que les Kss1p et Fus3p ne sont pas constitutivement activés dans un fol1Δ souche de délétion. Nous avons également testé le facteur de transcription Phd1p, dont on pense qu'il agit indépendamment des voies de l'AMPc et de la MAP kinase ( Palecek et al., 2002 ) et ont découvert que la croissance filamenteuse et envahissante de fol1Les cellules Δ ne dépendaient pas de Phd1p. Cela suggère que d'autres voies de signalisation agissant éventuellement par l'intermédiaire de Flo8p ou d'autres protéines peuvent être pertinentes pour la croissance filamenteuse en raison de la perte du transporteur C1 et doivent être testées. De même, la floculline Flo11p s'est avérée ne pas être nécessaire pour la croissance filamenteuse des cellules supprimées pour FOL1. Le fait que Flo11p ne soit pas requis pour la croissance filamenteuse suggère que d'autres mécanismes d'adhésion cellule-cellule et/ou de cytokinèse sont pertinents pour le phénotype de croissance filamenteuse. Un tel candidat pourrait être Fig 2p une adhésine spécifique à l'accouplement, qui, lorsqu'elle est surexprimée, peut partiellement compléter la perte d'adhérence trouvée dans un FLO11 souche mutante ( Guo et al., 2000 ). Alternativement, un manque de séparation mère-fille peut entraîner une augmentation de l'adhésion cellule-cellule et en effet un lien entre la maturation septale et l'adhésion cellulaire a été observé (Pan et Heitman, 2000).

Contrairement à la croissance filamenteuse de fol1Δ cellules le phénotype d'adhésion de la fol1La souche mutante Δ était dépendante de Ste12p et Flo11p mais pas de Tec1p. Nous avons donc testé si la suppression de FOL1 module le FLO11 activité de promoteur. En effet dans fol1Δ sollicite le FLO11 l'activité du promoteur a été renforcée d'une manière dépendante de Ste12p par rapport aux souches wt, démontrant que le signal de famine interne induit par l'épuisement du transporteur C1 est capable d'activer l'expression de la plus importante adhésine floculine cellule-cellule. Plus précisément le FLO11 les segments promoteurs -800 à -1200 et -2000 à -2400 ont été induits par la délétion de FOL1. Fait intéressant, il a été rapporté que Ste12p agit sur les mêmes segments de la FLO11 promoteur ( Rupp et al., 1999 ). Cependant, Ste12p contrôle un troisième segment du FLO11 promoteur situé à la position -1600 à -2000, qui n'a pas été activé dans un fol1Δ souche. Ainsi, nos données impliquent que l'activation de FLO11 expression par suppression de FOL1 implique certains mais pas tous les FLO11 éléments promoteurs régulés par la voie Ste12p.

Nos données montrent que la suppression du FOL1 entraîne une croissance adhésive dépendante de Ste12p et Flo11p mais indépendante de Tec1p et Phd1p, tandis que la croissance filamenteuse du fol1La souche Δ ne nécessite ni Ste12p, Tec1, Phd1p, ni Flo11p. Ce comportement du fol1La souche Δ suggère que l'invasion et la filamentation de la gélose sont provoquées par des signaux différents. Récemment, dans un criblage conçu pour trouver des mutants présentant une invasivité accrue, des souches ont été identifiées qui favorisent l'invasion de la gélose même lorsqu'elles sont FLO11 a été exprimé à un niveau constitutivement bas. Plus précisément, l'invasion de la gélose haploïde, la floculation, l'invasion diploïde et la filamentation diploïde pourraient être séparées génétiquement ( Palecek et al., 2000 ). Ainsi, bien que la réglementation des FLO11 la transcription fournit un mécanisme important de contrôle de croissance invasif, FLO11 la régulation positive n'est pas essentielle pour la croissance invasive et n'est pas encore induite par toutes les conditions qui déclenchent le commutateur dimorphique. Un ou plus FLO11-des mécanismes indépendants sont susceptibles d'exister pour la croissance invasive ( Palecek et al., 2000 Rua et al., 2001 ). Il a été suggéré que la réponse de croissance invasive est déclenchée par de nombreux intrants physiologiques et génétiques différents ( Breitkreutz et al., 2003 ). De même, nos données suggèrent qu'il existe une FLO11-mécanisme(s) indépendant(s) conduisant à fol1Croissance pseudohyphe induite par Δ.


SYNDROME MÉTABOLIQUE

Le syndrome métabolique est un terme utilisé pour encapsuler un ensemble complexe de marqueurs associés à un risque accru de maladie cardiaque. Le profil comprend (1) une résistance à l'insuline et un métabolisme dysfonctionnel du glucose dans les cellules musculaires (2) un excès de triglycérides dans le sérum sanguin (3) des taux élevés de LDL, en particulier de petits LDL denses, le pire (4) des taux faibles de HDL (le " bon » cholestérol) et une teneur réduite en cholestérol dans les particules individuelles de HDL (5) une pression artérielle élevée et (6) l'obésité, en particulier l'excès de graisse abdominale. J'ai soutenu précédemment que ce syndrome est provoqué par un régime riche en glucides vides (en particulier en fructose) et pauvre en graisses et en cholestérol, ainsi qu'un mauvais statut en vitamine D. 35 Bien que je continue de croire que tous ces facteurs sont contributifs, j'ajouterais maintenant un autre facteur : une insuffisance de sulfate alimentaire.

J'ai décrit dans un essai précédent mon interprétation de l'obésité comme une condition motivée par un besoin de cellules adipeuses abondantes pour convertir le glucose en graisse parce que les cellules musculaires sont incapables d'utiliser efficacement le glucose comme carburant. Avec une carence en soufre vient la réponse à la raison pour laquelle les cellules musculaires seraient défectueuses dans la gestion du glucose : elles ne peuvent pas produire suffisamment de sulfate de cholestérol pour ensemencer le radeau lipidique nécessaire pour importer le glucose.

Une autre façon de surmonter le métabolisme défectueux du glucose d'une cellule musculaire consiste à faire de l'exercice vigoureusement, de sorte que l'AMPK généré (un indicateur de pénurie d'énergie) incite le GLUT4 à migrer vers la membrane même en l'absence d'insuline. 27 Une fois que le glucose est à l'intérieur de la cellule musculaire, cependant, le mécanisme fer-sulfate qui vient d'être décrit est dysfonctionnel, à la fois parce qu'il n'y a pas de sulfate de cholestérol et parce qu'il n'y a pas de peroxyde d'hydrogène. De plus, avec un exercice intensif, l'apport d'oxygène est également réduit, de sorte que le glucose doit être traité de manière anaérobie dans le cytoplasme pour produire du lactate. Le lactate est libéré dans la circulation sanguine et expédié au cœur et au cerveau, qui sont tous deux capables de l'utiliser comme carburant. Mais la membrane cellulaire reste appauvrie en cholestérol, ce qui la rend vulnérable aux futurs dommages oxydatifs.

Une autre façon de compenser le métabolisme défectueux du glucose dans les cellules musculaires est de prendre du poids. Les cellules adipeuses doivent maintenant convertir le glucose en graisse et le libérer dans la circulation sanguine sous forme de triglycérides, pour alimenter les cellules musculaires. Dans le cadre d'un régime pauvre en graisses, la carence en soufre aggrave le problème. Une carence en soufre interfère avec le métabolisme du glucose, c'est donc un choix beaucoup plus sain d'éviter simplement les sources de glucose (glucides) dans l'alimentation, c'est-à-dire d'adopter un régime très pauvre en glucides. Ensuite, la graisse dans l'alimentation peut fournir du carburant aux muscles, et les cellules graisseuses ne sont pas chargées d'avoir à stocker autant de graisse de réserve.

L'insuline supprime la libération des graisses des cellules graisseuses. 32 Cela force les cellules graisseuses à inonder la circulation sanguine de triglycérides lorsque les niveaux d'insuline sont bas, c'est-à-dire après des périodes prolongées de jeûne, comme la nuit. Les cellules adipeuses doivent déverser suffisamment de triglycérides dans la circulation sanguine pendant les périodes de jeûne pour alimenter les muscles lorsque l'apport alimentaire en glucides maintient les niveaux d'insuline élevés et que la libération de graisses par les cellules adipeuses est réprimée. Au fur et à mesure que les glucides alimentaires arrivent, les niveaux de sucre dans le sang augmentent considérablement car les cellules musculaires ne peuvent pas les utiliser.

Le foie transforme également l'excès de glucose en graisse et le conditionne en LDL, pour fournir davantage de carburant aux cellules musculaires défectueuses. Parce que le foie est tellement préoccupé par la transformation du glucose et du fructose en LDL, il prend du retard sur la génération de HDL, le « bon » cholestérol. Le résultat est donc des niveaux élevés de LDL, de triglycérides et de sucre dans le sang, et des niveaux réduits de HDL, quatre composants clés du syndrome métabolique.

La présence chronique d'excès de glucose et de fructose dans la circulation sanguine entraîne une multitude de problèmes, tous liés aux dommages de glycation des protéines de la circulation sanguine par exposition au glucose. L'une des protéines clés qui est endommagée est l'apolipoprotéine, apoB, qui est enfermée dans la membrane des particules LDL. L'apoB endommagé inhibe la capacité du LDL à délivrer efficacement son contenu (graisse et cholestérol) aux tissus. Les cellules adipeuses viennent à nouveau à la rescousse en éliminant les particules de LDL brisées (par un mécanisme qui ne nécessite pas d'apoB pour être en bonne santé), en les démontant, en extrayant et en reconditionnant leur cholestérol. Pour fonctionner correctement, les cellules graisseuses doivent avoir une apoE intacte, un antioxydant qui nettoie le cholestérol oxydé et le transporte jusqu'à la membrane cellulaire pour l'acheminer vers les particules HDL.


Résultats

Inhibition de la croissance sous NH élevé4 + correspond à un NH4 + explosion de ROS induite en excès dans les semis de riz

Sous traitement persistant avec NH élevé4 + (20 mM) pendant 14j, une inhibition de croissance significative a été observée par rapport à la condition contrôle (1 mM NH4 + ) (Fig. 1a). L'inhibition était plus profonde dans les racines montrant une réduction de la biomasse allant jusqu'à 67% (Fig. 1a) et le rapport racine/pousse a été significativement réduit d'environ 0,5 à 0,2 (Fig. 1b). Pendant ce temps, des concentrations 7 et 5 fois plus élevées de NH libre4 + ont été mesurés dans les racines et les pousses, respectivement (Fig. 1c). Néanmoins, la forte inhibition de la croissance racinaire sous haute teneur en NH4 + supplément était un problème bien défini qui avait suscité de nombreuses enquêtes. Des efforts considérables ont été déployés pour élucider les mécanismes moléculaires impliqués dans les ajustements de l'architecture racinaire en réponse à l'accumulation d'effets de stress à relativement long terme (plusieurs jours ou plus) provoqués par un NH élevé.4 + soins. Ici pour révéler des réactions réactives précoces qui pourraient être le déclencheur des réponses cumulatives (modifications de croissance), un état rapide de NH interne4 + l'excès est nécessairement à établir sans provoquer de changements visibles dans la croissance des plantes (en particulier les racines). Par conséquent, la L–méthionine–D,L–sulfoximine (MSX), un puissant inhibiteur du NH primaire4 + voie d'assimilation médiée par l'activité des glutamines synthétases [35] a été appliquée (1 mM) pendant 4 h en présence de NH élevé4 + (20 mm). Compte tenu de la forte toxicité du MSX, des conditions appropriées pour l'utilisation du médicament ont été pré-testées pour éviter les effets létaux qui conduisent à des lyses apoptotiques des composants cellulaires. Dans notre culture hydroponique, une incubation de 4 h avec 1 mM de MSX pourrait efficacement entraîner une NH aiguë4 + excès dans les racines et les pousses 5 à 6 fois supérieur à celui des conditions de contrôle sans aucun dommage visible sur les plantules de riz (Fig. 1d). Ainsi la méthode a permis de simuler aussi rapidement qu'en moins de 4 h, le NH « saturable »4 + circonstances excessives à l'intérieur des racines et des pousses à des niveaux similaires des traitements à long terme (comparer Fig. 1 c & d).

Analyses biologiques et physiologiques du NH4 + réponses excessives du riz. Des semis de riz âgés de 7 jours ont été soumis à NH4 + soins pendant 14 j (une-c, e). une Biomasses fraîches de racines et de pousses. b Ratios racine-pousse. c NH gratuit4 + contenu et e Contenu ROS total en réponse à NH4 + soins. NH aigu4 + simulation d'excès par traitement avec NH élevé4 + pendant 4 h en présence de MSX 1 mM. Les semis de riz utilisés pour cette expérience étaient âgés de 10 jours. Les valeurs indiquées signifient ± SE de trois répétitions indépendantes. ** et *** représentaient des significations statistiques à p<0,01 et 0,001, respectivement

En ligne avec l'accumulation de NH libre4 + , des explosions d'espèces réactives de l'oxygène (ROS) ont été observées (Fig. 1e), ce qui implique l'apparition possible de réactions induites par les ROS déclenchées par le NH interne4 + excès.

Démontrer davantage l'implication des espèces radicalaires dans la réponse précoce à NH4 + excès, nous avons réalisé respectivement des colorations histochimiques au DAB (3,3'-diaminobenzidine) et au NBT (nitroblue tetrazolium) pour tracer l'occurrence de H2O2 et ô2 − dans les racines nouvellement nées et les 2èmes feuilles des plants de riz traités ci-dessus. Les résultats ont montré que lors d'une exposition aiguë à des concentrations élevées de NH4 + , accumulation importante de H2O2 dans les feuilles et les racines a été détecté avec une forte coloration colorée (Fichier supplémentaire 1, Fig. S1, a & b). Les taches se sont facilement estompées pour se rapprocher des niveaux de contrôle à la suite d'une alimentation de 1 % de saccharose (fichier supplémentaire 1, fig. S1, a & b), indiquant le repli de l'H2O2 exploser aux niveaux normaux. En accord avec l'observation de H2O2, le NBT a coloré O2 − a montré des changements très similaires (Fichier supplémentaire 2, Fig. S2, a & b). Cet ensemble de données a soulevé des questions sur le fait que l'explosion de ROS (probablement indépendante de leur espèce de composition) était une étape d'initiation de la toxicité médiée par NH4 + excès. Par conséquent, un ensemble de réactions ou de réponses déclenchées par les ROS devrait avoir lieu comme décrit en détail pour les réponses au stress abiotique. En effet, d'après les mesures des teneurs en acides aminés libres (Fichier supplémentaire 3, Fig. S3), un NH élevé4 + a également provoqué une accumulation significative d'acides aminés libres dans les racines et les feuilles, ressemblant à une réponse protectrice commune de celle d'un stress de sécheresse ou de salinité.

Analyse RNA-Seq pour l'identification préliminaire de gènes modulés par NH4 + excédent

Selon la description ci-dessus, les semis de riz ont été traités avec une haute teneur en NH4 + en présence de 1 mM MSX pendant 4 h pour établir un environnement interne de NH4 + excès. Ensuite, des analyses RNA-Seq ont été réalisées pour rechercher des réponses moléculaires liées à cette circonstance. Respectivement 1077 et 1040 gènes différentiellement exprimés (DEG) ont été obtenus à partir de racines et de pousses, avec des changements > 2 fois dans leurs niveaux de transcription (Fichier supplémentaire 4). Sur la base de la classification GO, ces gènes appartenaient principalement au « processus métabolique », à la « fonction moléculaire », à la « liaison » et au « processus biologique » (Fichier complémentaire 5). Une analyse plus poussée de la voie KEGG a révélé des implications possibles des gènes sensibles (DEG) dans la réponse au stress, l'ajustement photosynthétique, les métabolismes des glucides et des acides aminés, la préparation des voies de signalisation hormonale et le réajustement de NH4 + transport (Fichier complémentaire 6). Les gènes régulés de manière significative ont été résumés ci-dessous dans le cadre des principaux processus auxquels ils participent.

Activation du cycle GSH pour le balayage des ROS

Suite à la NH aiguë4 + excès et les bouffées de ROS (Fig. 1c, d, e), une réponse des plus remarquables a été la forte induction des gènes des glutathion S–transférases (GST) (Fig. 2). Onze gènes GST étaient généralement régulés à la hausse pour > 7 ou même quelques dizaines à centaines de fois à la fois dans les racines et les pousses (Fig. 2ab, gènes # 1-11). Parmi ces GST, un OsGSTU4 (Os10g0528300, Fig. 2a, gene#11) était le plus sévèrement induit par > 300 et > 600 fois dans les racines et les pousses respectivement, suivi de 2 gènes GST putatifs (Os10g0481300 et Os10g0527800) qui ont été régulés positivement par 50 à 100 fois dans les deux parties. Alors que Os10g0525500 (77 fois) et Os03g0785900 (90 fois) ont montré une forte induction respectivement dans les racines et les pousses (Fig. 2a, b). Étant donné que les GST catalysent le transfert de radicaux libres superoxydes vers le glutathion réducteur (GSH) qui conduit à la détoxification des oxydants, ces changements dans l'expression du gène GST fournissent des indications pour l'implication critique du cycle du GSH dans le piégeage du NH.4 + ROS induit en excès.

Analyses de l'expression génique des gènes de piégeage ROS réactifs. une Les gènes différentiellement exprimés obtenus par RNA-Seq ont été illustrés en relation avec les voies principales dans lesquelles ils étaient impliqués. Les colonnes colorées correspondaient aux changements de pli des transcrits comme indiqué par la définition des gradients de couleur (en bas). Le symbole « + » et les colonnes de gradient rouge représentaient les gènes régulés à la hausse et le repli de l'induction, tandis que « - » et les colonnes de gradient vertes faisaient référence aux gènes régulés à la baisse. b La validation qRT-PCR de gènes sélectionnés au hasard codant pour les systèmes de piégeage des ROS. Les niveaux d'expression relatifs ont été normalisés par rapport à OsActin. Les valeurs indiquées étaient des moyennes de trois répétitions indépendantes. Les gènes réactifs numérotés ont été annotés comme suit : 1. Os01g0949700, glutathion S-transférase putatif 2. Os03g0785900, glutathion S-transférase probable GSTU1 3. Os01g0369700, glutathion transférase putatif 4 4. Os01g0949800, glutathion S-transférase putatif 5. Os01g09497900, putatif glutathion transférase S-transférase 6. Os10g0365200, glutathion S-transférase 7. Os10g0527800, glutathion S-transférase OsGSTU12 8. Os10g0481300, glutathion S-transférase 9. Os10g0525500, glutathion S-transférase parC 10. Os01g0372400, glutathion supposé 11. glutathion S-transférase OsGSTU4 12. Os10g0415300, glutathion réductase 13. Os08g0557600, monodéhydroascorbate réductase 14. Os07g0638400, 1-Cys peroxirédoxine B 15. Os05g0499300, peroxydase 1 16. Os07g0677300, peroxydase 2 17. Os600g01, peroxydase 2 17. Os600g01g01 Peroxydase de classe III 27 19. Os03g0234900, peroxydase de classe III 39 20. Os03g0368000, peroxydase de classe III 42 21. Os06g0695300, classe III peroxydase 92 22. Os07g0564500, NADH déshydrogénase [EC:1.6.99.3]

Conformément à la demande renforcée de pouvoir réducteur, un gène putatif de la glutathion réductase (Os10g0415300) responsable du recrutement du GSH a été modérément régulé à la hausse (

8 fois) dans les racines et vigoureusement renforcée par 70 fois dans les pousses (Fig. 2a). Pendant ce temps, un gène de la NADH déshydrogénase (Os07g0564500) a été stimulé par 127 fois dans les pousses, reflétant en partie le couplage de l'activation et de la puissance réductrice avec le fonctionnement du cycle GSH (Fig. 2a).

En plus des changements profonds liés au cycle du GSH, 7 gènes de la peroxydase ont été supprimés dans les racines alors qu'un gène putatif de la peroxiredoxine B 1-Cys (Os07g0638400) a été induit de manière significative à la fois dans les racines (19 fois) et les pousses (179 fois) (Fig. 2a ), correspondant aux rôles contradictoires des peroxydases dans le maintien du clivage/homéostasie des ROS [36].

Suppression des composants de la photosynthèse et régulation contrastée du métabolisme des glucides produisant de l'énergie

Les protéines de liaison à la chlorophylle a/b des complexes collecteurs de lumière (LHC), également appelées protéines d'antenne, sont impliquées dans la collecte d'énergie lumineuse (photons) de la réaction primaire de la photosynthèse [37]. Ensuite, les photons et les électrons piégés sont transportés vers le centre de réaction pour d'autres réactions photochimiques. La perturbation de ces processus par le photodommage, les herbicides ou l'accumulation de radicaux hautement actifs entravera évidemment le progrès de la photosynthèse. Sur demande (4 h) NH4 + traitement excessif, 6 gènes codant pour les protéines d'antenne du LHC (4 LHC II et 2 LHC I, respectivement), un des gènes du centre de réaction PS I et PS II ont été presque uniformément supprimés d'environ 5 fois (Fig. 3), indiquant la début de la réduction de l'efficacité de la collecte et du transfert de photons. Il serait facile de supposer que la suppression apparente de la photosynthèse s'accumulerait le long de la progression de NH4 + un excès de stress et une inhibition de la croissance se produiraient par conséquent. Pendant ce temps, Os12G0292400 codant pour la petite chaîne de Rubisco, l'enzyme clé catalyse la fixation/assimilation du CO2, a été régulé à la baisse par

5 fois (Fig. 3), fournissant une indication supplémentaire de la production de carbone photosynthétique compromise. Par conséquent, la plante NH4 + l'excès initie et développe probablement aussi la perturbation de la photosynthèse en interférant dans la réaction primaire et le cycle de Calvin.

Gènes sensibles impliqués dans la photosynthèse. Les gènes différentiellement exprimés obtenus par RNA-Seq ont été illustrés en relation avec les principaux processus auxquels ils étaient impliqués. Les colonnes colorées correspondaient aux changements de pli des transcrits comme indiqué par la définition des gradients de couleur (en bas). Le symbole « + » et les colonnes de gradient rouge représentaient les gènes régulés à la hausse et le repli de l'induction, tandis que « - » et les colonnes de gradient vertes faisaient référence aux gènes régulés à la baisse. Les gènes sensibles numérotés ont été annotés comme suit : 23. Os03g0592500, protéine de liaison 2 de la chlorophylle a/b du complexe II de récolte de lumière 2 (LHCB2) 24. Os07g0558400, protéine de liaison 4 de la chlorophylle a/b du complexe II de récolte de lumière 4 (LHCB4) 25. Os01g0720500, Complexe de récolte de lumière II protéine de liaison à la chlorophylle a/b 1 (LHCB1) 26. Os09g0346500, protéine de liaison à la chlorophylle a/b du complexe II de récolte de lumière 1 (LHCB1) 27. Os03g0333400, protéine du photosystème II Psb27 (psb27) 28. (Os08g0560900) , photosystème I sous-unité II (psaD) 29. Os06g0320500, complexe de récolte de lumière I protéine de liaison à la chlorophylle a/b 1 (LHCA1) 30. Os02g0197600, complexe de récolte de lumière I protéine de liaison à la chlorophylle a/b 3 (LHCA3) 31. Os12g0292400, ribulose-bisphosphate carboxylase à petite chaîne [EC:4.1.1.39] (rbcS)

Les enzymes de piégeage des radicaux sont activées et énergisées par les processus de production d'ATP, notamment la glycolyse et les voies du TCA. Cependant, plusieurs gènes impliqués dans la glycolyse et le cycle du TCA étaient régulés de manière contrastée dans les racines et les pousses (Fig. 4). Dans les racines, gènes codant pour 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (Os05g0482700, gene#33) et fructose-bisphosphate aldolases (Os08g0120600, gene#34 et Os01g0905800, gene#35) de la glycolyse, isocitrate déshydrogénase (Os05g0573200, gène 36) et la malate déshydrogénase (Os05g0574400, gène n°37) du cycle du TCA ont été régulées à la baisse de 6 à 10 fois après 4 h de NH4 + traitements en excès (Fig. 4a). Pendant ce temps, les gènes impliqués dans la dégradation du glycogène ont été supprimés dans les racines (Fig. 4a) : phosphoénolpyruvate carboxykinase (Os10g0204400, gène n°32, − 19 fois), bêta-glucosidase (Os09g0491100, gène n° 40, − 11 fois), bêta-glucosidase (Os02g0131400 , foldgene#41,-15 fois), bêta-D-xylosidase 4 (Os04g0640700, gene#42, -7fold), saccharose synthase (Os03g0401300, gene#43, -8fold), bêta-fructofuranosidase (Os02g0106100, gene#44, − 11 fois). Au contraire, une augmentation de la glycolyse/de la dégradation du glycogène dans les pousses pourrait être indiquée par la régulation à la hausse de gènes apparentés (Fig. 4b) : glucose-6-phosphate 1-déshydrogénase (Os02g0600400, gène n°39, + 5 fois), pyrophosphatase inorganique (Os05g0438500 , gène n°49, + 18 fois), phosphoénolpyruvate carboxykinase (Os10g0204400, gène n°32, + 34 fois), bêta-glucosidase (Os05g0366600, gène n°47, + 12 fois), bêta-glucosidase (Os09g0511600, gène n°48, + 20 fois). Notamment, un gène de la pyruvate décarboxylase (Os05g0469600, gène #38) de la glycolyse, a été spécifiquement induit dans les pousses (Fig. 4b). De plus, deux gènes Os06g0222100 et Os08g0445700 codant pour la tréhalose 6-phosphate synthase/phosphatases ont été induits respectivement par 15 et 13 fois dans les racines (Fig. 4a, gènes #45,46), suggérant une biosynthèse améliorée de la « substance de survie » [32 ] tréhalose induit par NH4 + excès de stress.

Gènes réactifs impliqués dans le métabolisme des glucides dans les racines (une) et pousses (b). Les gènes différentiellement exprimés obtenus par RNA-Seq ont été illustrés en relation avec les principaux processus auxquels ils étaient impliqués. Les colonnes colorées correspondaient aux changements de pli des transcrits comme indiqué par la définition des dégradés de couleurs (en bas). Le symbole « + » et les colonnes de gradient rouges représentaient les gènes régulés à la hausse et le repli de l'induction tandis que « - » et les colonnes de gradient vertes faisaient référence aux gènes régulés à la baisse. Les gènes sensibles numérotés ont été annotés comme suit : 32. Os10g0204400, phosphoénolpyruvate carboxykinase (ATP) [EC:4.1.1.49] (pckA) 33. Os05g0482700, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase [EC:5.4.2.12] (gpmI) 34. Os08g0120600, fructose-bisphosphate aldolase, classe I [EC:4.1.2.13] (ALDO) 35. Os01g0905800, fructose-bisphosphate aldolase, classe I [EC:4.1.2.13] (ALDO) 36. Os05g0573200, isocitrate déshydrogénase [EC :1.1.1.42] (IDH) 37. Os05g0574400, malate déshydrogénase [EC:1.1.1.37] (MDH2) 38. Os05g0469600, pyruvate décarboxylase [EC:4.1.1.1] 39. Os02g0600400, glucose-6-phosphate 1-déshydrogénase [ EC:1.1.1.49] (G6PD) 40. Os09g0491100, bêta-glucosidase [EC :3.2.1.21] 41. Os02g0131400, bêta-glucosidase [EC :3.2.1.21] 42. Os04g0640700, bêta-D-xylosidase 4 [EC : 3.2.1.37] (XYL4) 43. Os03g0401300, saccharose synthase [EC:2.4.1.13] 44. Os02g0106100, bêta-fructofuranosidase [EC:3.2.1.26] (sacA) 45. Os08g0445700, tréhalose 6-phosphate synthase / phosphatase [EC :2.4.1.15 3.1.3.12] ( TPS) 46. Os06g0222100, tréhalose 6-phosphate phosphatase [EC:3.1.3.12] (otsB) 47. Os05g0366600, bêta-glucosidase [EC:3.2.1.21] 48.Os09g0511600, bêta-glucosidase [EC:3.2.1.21], 49. Os05g0438500, pyrophosphatase inorganique [EC:3.6.1.1]

L'alimentation en saccharose atténue le NH4 + réponses excessives au stress

Les analyses ci-dessus ont révélé des réponses plutôt frustrantes à NH4 + excès de stress chez la plante de riz étroitement associé à la consommation de glucides pour la demande énergétique. Par conséquent, une pénurie de sucre pourrait entraîner une inhibition de la croissance de manière cumulative (à plus long terme). Pour tester cette hypothèse, nous avons nourri 1% de saccharose en guise de compensation de sucre pour le NH élevé4 + (20 mM) culture hydroponique pendant 24 h. Ce traitement a compensé la consommation de saccharose à NH élevé4 + et a permis aux teneurs en saccharose dans les racines et les pousses de revenir à des niveaux équivalents du témoin (1 mM NH4 + ) conditions (Fig. 5a). Les traitements d'alimentation en saccharose ont encore augmenté le NH libre4 + teneur en racines, mais NH significativement réduit4 + accumulation aux pousses (Fig. 5b).

Effets de l'alimentation en saccharose sur NH4 + processus d'accumulation, d'absorption et d'assimilation. Des semis âgés de 10 jours ont été soumis à un témoin (1 mM NH4 + ), NH élevé4 + (20 mM) ou NH élevé4 + + suc (20 mM NH4 + + 1% de saccharose) traitements pendant 24 h. une Teneur en saccharose, b NH gratuit4 + contenu, c les profils d'expression de OsAMT11, OsAMT12 et OsAMT13 déterminés par qRT-PCR, activité enzymatique GS, e Activité enzymatique GOGAT. Les données étaient des moyennes ± SE de trois répétitions indépendantes. Les lettres sur les barres représentaient des significations statistiques

Sous haute NH4 + conditions, les niveaux d'expression de 3 gènes AMT1 (OsAMT11–Os04g0509600, OsAMT12–Os02G0620500 et OsAMT13–Os02G0620600) ont été supprimés respectivement par 3, 67 et 6 fois dans les racines, impliquant une réduction de NH4 + activité d'absorption. Avec le supplément de saccharose (1%) au NH élevé4 + culture hydroponique (Fig. 5c), leurs niveaux d'expression restaurés à des niveaux proches des niveaux "normaux" (à 1 mM NH4 + ).. Cela impliquait une libération d'activité de transport d'ammonium à partir de la suppression par NH4 + excès, donc contribué à l'amélioration de NH4 + accumulation dans les racines sous NH élevé4 + plus saccharose. Alors que le NH libre réduit4 + contenu dans les mêmes conditions dans les pousses a indiqué probablement l'utilisation efficace de NH4 + lors de l'ajout de saccharose (Fig. 5b). Pendant ce temps, les activités GS (Fig. 5d) et GOGAT (Fig. 5e) ont été respectivement augmentées de 17% (GS) et 29% (GOGAT) dans les racines suite aux traitements d'alimentation en saccharose, indiquant une restauration de NH4 + activités d'assimilation à partir de la suppression initiale par NH4 + excès.

Lors de la compensation de la source de saccharose, les teneurs totales en ROS dans les racines et les pousses ont été abaissées de 20 à 30%, proches des niveaux déterminés au contrôle (1 mM NH4 + ) (Fig. 6a). En conséquence, la teneur en GSH et l'activité GST ont été significativement réduites aux niveaux initiaux (à 1 mM de NH4 + ), ne montrant plus une forte induction par NH4 + excès (Fig. 6b, c). De manière inattendue, aucun changement significatif n'a été observé avec les activités des enzymes de défense classiques CAT, POD et SOD sous l'un ou l'autre traitement (Fig. 6d, e, f). Avec les analyses d'expression génique (Fig. 2), nos résultats ont démontré que l'activation de la voie de réduction du GSH est probablement une réponse caractéristique du riz dans le traitement de NH4 + excès et accumulation de ROS. Enfin, en cohérence avec la diminution du niveau de ROS, l'activité Rubisco a été élevée de 24% (par rapport à un NH élevé4 + ) dans les pousses avec la présence d'alimentation en saccharose (Fig. 6g), suggérant une efficacité accrue du CO primaire2 activité de fixation.

Effets de l'alimentation en saccharose sur l'accumulation de ROS, les enzymes de piégeage des ROS et les activités de Rubisco. Des semis âgés de 14 jours ont été soumis à un contrôle (1 mM NH4 + ), NH élevé4 + (20 mM) ou NH élevé4 + + suc (20 mM NH4 + + 1% de saccharose) traitements pendant 24 h. une Accumulation totale de ROS représentée par les degrés de fluorescence, b Contenu GSH, c-g Tests d'activité enzymatique pour c TPS, CHAT, e COSSE, F SOD et g Rubisco. Les conditions expérimentales étaient les mêmes que celles décrites sur la figure 5. Les données ont été exprimées sous forme de moyennes ± SE de trois répétitions indépendantes. Les lettres sur les barres représentaient des significations statistiques

Pris ensemble, cet ensemble d'expériences a indiqué que l'alimentation en saccharose pourrait soulager efficacement les plants de riz des pénuries de carbone exercées par le NH interne.4 + contraintes excessives et ROS.


RÉSULTATS

Il existe deux profils de localisation d'ARNm par rapport aux Pbodies après une privation de glucose

Afin d'inspecter et de suivre la localisation d'ARNm spécifiques dans des S. cerevisiae cellules, nous avons utilisé le système mTAG Haim et al., 2007. Une explication détaillée de cette technique a été fournie ailleurs HaimVilmovsky et Gerst, 2009 cependant, en bref, la copie génomique d'une séquence d'ARNm est étiquetée dans son 3UTR avec des boucles souches MS2 . Cela permet la visualisation de l'ARNm via la coexpression de la protéine d'enveloppe MS2 fusionnée à trois protéines fluorescentes vertes CPGFP3. De tels systèmes ont été largement utilisés pour examiner la localisation des ARNm dans un large éventail de systèmes biologiques Haim et al., 2007 Hamada et al., 2003 Sheth et Parker, 2006. Les principaux avantages de ce système de levure sont que les éléments de contrôle associés à Les promoteurs de transcription et de traitement de l'ARNm, les UTR, les sites polyA et les terminateurs restent intacts, car les sites de liaison MS2 sont insérés directement et précisément dans le 3UTR du gène endogène à son locus chromosomique Haim et al., 2007. Une limitation potentielle de l'approche est que l'insertion des tiges-boucles MS2 pourrait modifier des aspects du comportement d'un ARNm. Cependant, un certain nombre d'ARNm ont été évalués fonctionnellement après l'insertion de MS2 et se sont avérés non affectés Haim et al., 2007. Par conséquent, en utilisant ce système, la localisation de un ARNm peut être évalué dans des cellules vivantes, ce qui permet d'évaluer les réponses à des signaux externes changeants.

Au départ, nous avons marqué de nombreuses séquences d'ARNm avec des tiges-boucles MS2. Ces ARNm ont été sélectionnés car ils sont très abondants et les produits protéiques sont associés à une variété de fonctions supplémentaires. On pourrait prédire que l'ajout des boucles de tige MS2 augmenterait la stabilité de l'ARNm. Cependant, la plupart des souches résultantes présentaient peu de différence dans le niveau d'expression des ARNm marqués MS2 par rapport au niveau d'ARNm non marqué dans les souches de type sauvage, tel que jugé par transcription inverse quantitative qRTPCR. Niveaux de la PGK1 et RPS16A Les ARNm ont en fait diminué avec le matériel supplémentaire de séquences MS2 ajouté Fig. S1. On ne sait pas actuellement comment cette diminution du niveau d'ARNm se produit. Néanmoins, les niveaux des ARNm marqués MS2 testés sont de type sauvage ou inférieurs à cela. Les souches d'ARNm marquées MS2 contenaient également les marqueurs Dcp2pcyan fluorescent protein CFP et Cdc33pred fluorescent protein RFP. Dcp2p est la sous-unité catalytique de l'enzyme de décapsulation et sert de marqueur pour les Pbodies, tandis que Cdc33p est le facteur d'initiation de la traduction eIF4E qui lie la coiffe d'ARNm et pénètre à la fois dans les Pbodies et les EGPbodies dans les granules de stress. Dans ces souches marquées, nous définissons donc les EGPbodies comme hébergeant eIF4E mais pas le marqueur Pbody Dcp2p.

Dès le départ, il était évident que les ARNm tombaient dans deux catégories de localisation d'ARNm. La première classe d'ARNm observée à l'aide du système mTAG est caractérisée par des ARNm qui se sont colocalisés avec le marqueur Pbody Dcp2CFP tôt après la formation des Pbodies, c'est-à-dire après 10 minutes de privation de glucose. Fig.1. Ces ARNm n'ont également présenté aucune augmentation réelle du niveau d'association Pbody de 10 à 50 minutes après la privation de glucose. De plus, il y avait peu de preuves que ces ARNm se sont accumulés dans des granules qui hébergent eIF4E mais manquent de Dcp2p, c'est-à-dire des granules de stress EGPbodies. L'examen de la localisation de ces ARNm dans des conditions de non-stress a révélé qu'ici aussi ils étaient présents dans le matériel supplémentaire des granules d'ARNm Fig. S2. Dans ces conditions sans stress, ni les composants de désintégration de l'ARNm ni les facteurs d'initiation de la traduction ne présentent de localisation granulaire Hoyle et al., 2007 et données non présentées. Une caractérisation détaillée et une analyse fonctionnelle des granules d'ARNm présents dans les cellules en croissance exponentielle seront publiées ailleurs. Dans cette étude actuelle, nous nous sommes concentrés sur la localisation des ARNm dans les Pbodies et les granules de stress, et cette classe d'ARNm pénètre dans les Pbodies tôt après leur formation. Deux de ces ARNm, RPS16A et RPS23B, codent pour des protéines ribosomiques. Un ciblage rapide des ARNm codant pour les protéines ribosomiques vers les Pbodies, très probablement pour la dégradation, est en accord avec des recherches antérieures montrant que ces ARNm diminuent rapidement dans les polysomes après une privation de glucose Arribere et al., 2011. Un autre ARNm de cette classe est PGK1, qui code pour l'enzyme glycolytique phosphoglycérate kinase. Auparavant, en utilisant une stratégie de localisation d'ARNm basée sur le plasmideU1A, nous avons montré que le PGK1 ARNm partiellement colocalisé avec eIF4E dans les granules Hoyle et al., 2007. Ici, en utilisant le système mTAG dans des souches où eIF4E et Dcp2p peuvent être visualisés simultanément, nous avons déterminé que le PGK1Les granules contenant de l'ARNm sont des Pbodies qui contenaient également eIF4E Fig.1. Dans l'ensemble, cette première classe d'ARNm est présente tôt dans Pbodies et ne se localise pas dans les granules de stress EGPbodies.

Les ARNm de phase précoce sont présents dans les Pbodies tôt après l'épuisement du glucose. Images de microscopie à fluorescence de cellules de levure à deux moments différents après l'épuisement du glucose. Les RPS16A, RPS23B et PGK1 Les ARNm sont suivis à l'aide du système mTAG MS2GFP, les composants de désintégration de l'ARNm sont suivis à l'aide de Dcp2p étiqueté CFP et les composants du complexe en boucle fermée sont suivis à l'aide d'eIF4E étiqueté RFP dans les mêmes cellules. Les images superposées colorées après 50 minutes d'épuisement du glucose illustrent des exemples où les ARNm se colocalisent avec les triangles jaunes Pbodies mais pas avec les losanges blancs EGPbodies. Les graphiques à droite représentent le pourcentage de Pbodies ou EGPbodies qui hébergent chaque ARNm après 10 minutes de barres blanches et 50 minutes de barres grises d'épuisement du glucose. Barres d'échelle 5 m.

Les ARNm de phase précoce sont présents dans les Pbodies tôt après l'épuisement du glucose. Images de microscopie à fluorescence de cellules de levure à deux moments différents après l'épuisement du glucose. Les RPS16A, RPS23B et PGK1 Les ARNm sont suivis à l'aide du système mTAG MS2GFP, les composants de désintégration de l'ARNm sont suivis à l'aide de Dcp2p étiqueté CFP et les composants du complexe en boucle fermée sont suivis à l'aide d'eIF4E étiqueté RFP dans les mêmes cellules. Les images superposées colorées après 50 minutes d'épuisement du glucose représentent des exemples où les ARNm se colocalisent avec les triangles jaunes Pbodies mais pas avec les losanges blancs EGPbodies. Les graphiques à droite représentent le pourcentage de Pbodies ou EGPbodies qui hébergent chaque ARNm après 10 minutes de barres blanches et 50 minutes de barres grises d'épuisement du glucose. Barres d'échelle 5 m.

Nous avons également identifié une deuxième classe d'ARNm qui présentait des cinétiques de localisation différentes. Ces ARNm n'étaient pas localisés à la fois dans des conditions de non-stress matériel supplémentaire Fig. S2 et après 10 minutes d'épuisement du glucose à un moment où Pbodies s'était déjà formé, à en juger par la localisation de Dcp2pCFP Fig.2. Par conséquent, à ce stade précoce, la majorité des Pbodies n'avaient pas l'ARNm marqué. Cependant, après 50 minutes de privation de glucose, la localisation de ces ARNm aux Pbodies s'est produite Fig.2. En ce qui concerne la première classe d'ARNm, il existe peu de preuves que ces ARNm se sont accumulés dans des granules qui abritent eIF4E mais manquent de Dcp2p, c'est-à-dire de granules de stress EGPbodies. Ainsi, il semble que cette deuxième classe d'ARNm se localise dans les Pbodies sur une période prolongée après le stress, et ne se localise pas dans les granules de stress des EGPbodies.

Les ARNm de phase tardive pénètrent dans les corps P après une période prolongée de privation de glucose. Comme Fig.1, suivant SPG4, SUE1, VNX1, TDP1 et RRP43 ARNm par rapport à la désintégration de l'ARNm et aux composants du complexe en boucle fermée. Les images superposées colorées après 50 minutes d'épuisement du glucose illustrent des exemples où les ARNm se colocalisent avec les triangles jaunes Pbodies mais pas avec les losanges blancs EGPbodies. Les graphiques à droite montrent que le pourcentage de Pbodies hébergeant chaque ARNm augmente de 10 minutes de barres blanches à 50 minutes de barres grises d'épuisement du glucose, alors qu'une colocalisation minimale avec les EGPbodies a été observée. Barres d'échelle 5 m.

Les ARNm de phase tardive pénètrent dans les corps P après une période prolongée de privation de glucose. Comme Fig.1, suivant SPG4, SUE1, VNX1, TDP1 et RRP43 ARNm par rapport à la désintégration de l'ARNm et aux composants du complexe en boucle fermée. Les images superposées colorées après 50 minutes d'épuisement du glucose représentent des exemples où les ARNm se colocalisent avec les triangles jaunes Pbodies mais pas avec les losanges blancs EGPbodies. Les graphiques à droite montrent que le pourcentage de Pbodies hébergeant chaque ARNm augmente de 10 minutes de barres blanches à 50 minutes de barres grises d'épuisement du glucose, alors qu'une colocalisation minimale avec les EGPbodies a été observée. Barres d'échelle 5 m.

Une entrée prolongée d'ARNm dans Pbodies est cohérente avec un modèle actuel de répression traductionnelle après une privation de glucose Castelli et al., 2011. Dans ce modèle, une perte de l'hélicase à ARN eIF4A de l'ARNm inhiberait l'initiation de la traduction. Cependant, sur une courte période après le stress, la perte d'eIF4A provoquerait l'accumulation du complexe de pré-initiation 48S. Sur une période plus prolongée, ce complexe 48S bloqué se briserait, permettant la libération lente de l'ARNm associé aux composants du complexe en boucle fermée. Cela pourrait expliquer pourquoi eIF4E n'a été localisé sur les Pbodies qu'à 50 minutes, mais pas à 10 minutes, après le stress glycémique. ARNm évalués dans cette étude, seul un faible pourcentage de l'ARNm marqué était présent dans les Pbodies qui contiennent également du matériel supplémentaire eIF4E Fig. S3. Bien qu'il soit encore possible que les ARNm entrent dans les Pbodies dans le cadre du complexe en boucle fermée, cette quantification a également mis en évidence une possibilité alternative que le complexe en boucle fermée se décompose avant ou pendant le mouvement de ces ARNm vers les Pbodies.

Afin de comparer le moment de l'entrée de l'eIF4E et de l'ARNm en fin de phase à Pbodies, un cours de temps plus complet a été effectué en utilisant le TDP1 ARNm. Ici, le moment le plus précoce auquel la localisation vers Pbodies est observable, pour eIF4E ou le TDP1 ARNm, était de 30 minutes après la privation de glucose Fig.3. Cette coïncidence apparente dans le moment du mouvement pour les facteurs d'initiation de la traduction en boucle fermée et un ARNm en fin de phase soutient un modèle où au moins une partie de l'ARNm se déplace vers Pbodies tout en étant toujours associée au complexe en boucle fermée, à la suite d'une association prolongée avec la machinerie traductionnelle après famine de glucose. Une question évidente de cette comparaison de l'entrée tardive de l'ARNm et de l'eIF4E dans les Pbodies est de savoir pourquoi eIF4E ne se déplace pas dans les Pbodies avec les premiers ARNm. Une explication possible est que le complexe mRNP de particules de ribonucléoprotéine messagère réprimé par la traduction pour les ARNm précoces diffère de celui des ARNm tardifs, et que, par conséquent, le mécanisme de transfert aux Pbodies diffère.

Évolution dans le temps de la localisation d'un ARNm de phase tardive aux Pbodies par rapport à eIF4E. Images de microscopie à fluorescence de cellules de levure au cours du temps après l'épuisement du glucose. Les TDP1 L'ARNm est suivi à l'aide du système mTAG via la rangée médiane MS2GFP, les composants de désintégration de l'ARNm sont suivis à l'aide de la rangée supérieure Dcp2p étiquetée CFP et les composants du complexe en boucle fermée sont suivis à l'aide de la rangée inférieure eIF4E étiquetée RFP. Un triangle blanc met en évidence le moment où eIF4E et l'ARNm sont d'abord observés en colocalisation avec le marqueur Pbody. Barre d'échelle 5 m.

Évolution dans le temps de la localisation d'un ARNm de phase tardive aux Pbodies par rapport à eIF4E. Images de microscopie à fluorescence de cellules de levure au cours du temps après l'épuisement du glucose. Les TDP1 L'ARNm est suivi à l'aide du système mTAG via la rangée médiane MS2GFP, les composants de désintégration de l'ARNm sont suivis à l'aide de la rangée supérieure Dcp2p étiquetée CFP et les composants du complexe en boucle fermée sont suivis à l'aide de la rangée inférieure eIF4E étiquetée RFP. Un triangle blanc met en évidence le moment où eIF4E et l'ARNm sont d'abord observés en colocalisation avec le marqueur Pbody. Barre d'échelle 5 m.

La localisation des ARNm en fin de phase nécessite des Pbodies

Afin d'explorer les exigences mécanistiques pour ces deux phases dans le recrutement d'ARNm aux Pbodies, nous avons utilisé le lsm4C edc3 mutant, qui ne parvient pas à former Pbodies. Les protéines Lsm4p et Edc3p contiennent des domaines spécifiques qui sont essentiels à la formation de Pbody, probablement en raison de leur potentiel d'agrégation Decker et al., 2007. Par conséquent, les souches portant les divers ARNm marqués MS2 ont été rétrocroisées individuellement à lsm4C edc3 souches mutantes. Comme prévu, pour tous les résultats lsm4C edc3 souches mutantes, Pbodies ne s'est pas formé après 10 ou 50 minutes d'épuisement du glucose Fig.4. Les ARNm de phase tardive, tels que TDP1 et VNX1, n'étaient pas localisés à des moments précoces ou tardifs après la privation de glucose dans le fond mutant. Ce résultat suggère que la localisation de ces ARNm en phase tardive dépend de la formation de Pbodies Fig.4. En revanche, RPS16A L'ARNm a été observé dans les granules en l'absence totale de formation de Pbody. Cette observation concerne très probablement la localisation de ces ARNm dans des granules dans des cellules non stressées, où les Pbodies ne sont pas observés. Ces résultats suggèrent que la distinction entre les ARNm de phase précoce et tardive réside non seulement dans le moment de la localisation mais également dans les mécanismes moléculaires précis de la localisation de l'ARNm pour chaque classe d'ARNm.

La localisation de l'ARNm en fin de phase repose sur la formation de Pbody. Images de fluorescence de cellules de levure après 50 minutes d'épuisement du glucose. lsm4C edc3 des souches mutantes ont été générées qui portent les ARNm marqués MS2 marqués sur la gauche. Ce mutant est déficient dans la formation de Pbody, comme le montre le manque de localisation de Dcp2pCFP. Les RPS16A L'ARNm fournit un exemple où les ARNm de phase précoce s'agrègent encore, alors que la localisation n'est pas observée pour deux ARNm de phase tardive, VNX1 et TDP1. Barres d'échelle 5 m.

La localisation de l'ARNm en fin de phase repose sur la formation de Pbody. Images de fluorescence de cellules de levure après 50 minutes d'épuisement du glucose. lsm4C edc3 des souches mutantes ont été générées qui portent les ARNm marqués MS2 marqués sur la gauche. Ce mutant est déficient dans la formation de Pbody, comme le montre le manque de localisation de Dcp2pCFP. Les RPS16A L'ARNm fournit un exemple où les ARNm de phase précoce s'agrègent encore, alors que la localisation n'est pas observée pour deux ARNm de phase tardive, VNX1 et TDP1. Barres d'échelle 5 m.

Bfr1p est une protéine Pbody à entrée tardive

Afin de dépister les facteurs de copurification avec les facteurs de désintégration de l'ARNm Xrn1p et Dcp2p, nous avons utilisé la chromatographie TAP de purification par affinité en tandem pour extraire Dcp2pTAP et Xrn1pTAP des souches TAP étiquetées appropriées.De nombreuses protéines en interaction ont été identifiées qui ont des connexions avec l'ARN, ou sont associées à des Pbodies, celles-ci seront présentées plus en détail ailleurs. Une protéine particulièrement importante qui a été identifiée par spectrométrie de masse dans ces pull downs était Bfr1p Table1. Bfr1p est une protéine de liaison à l'ARNm qui a été initialement identifiée comme un suppresseur de forte copie de l'antibiotique lactone brefeldinA Jackson et Kps, 1994. Des études plus récentes ont montré que Bfr1p interagit avec un complexe de liaison à l'ARNm contenant des protéines de liaison à l'ARN, telles que Scp160p Lang et al., 2001 Scheuner et al., 2001 Sezen et al., 2009. Scp160p et Bfr1p colocalisent avec le réticulum endoplasmique de la levure ER selon un motif caractéristique autour du noyau cortical ER et juste sous le RE périphérique de la membrane cellulaire Mitchell et al., 2013 Sezen et al. , 2009. Il a également été démontré que le complexe contenant Bfr1p se localisait dans les polysomes des cellules en croissance exponentielle, ce qui suggère qu'il est activement impliqué dans la régulation de la traduction Sezen et al., 2009. Sur cette base, l'interaction potentielle entre Bfr1p et les facteurs de dégradation de l'ARNm présents dans Pbodies a fait l'objet d'une enquête plus approfondie.


Remerciements

Nous remercions Julien Gagneur pour ses suggestions sur la normalisation et les modèles linéaires généralisés Arnaud Bonnaffoux, Florent Chuffart, Pascal Hersen, Abderrahman Khila, Sébastien Lemaire, Serge Pelet et Alexandre Soulard pour les discussions Julien Gagneur, Steve Garvis, Jun-Yi Leu, Stephen Proulx, Mark Siegal et Henrique Teotonio pour la lecture critique du manuscrit Audrey Barthelaix pour les premiers tests sur la plateforme robotique David Stillman pour les plasmides Sandrine Mouradian et SFR Biosciences Gerland-Lyon Sud (UMS3444/US8) pour l'accès aux cytomètres en flux et l'assistance technique BioSyL Federation et Ecofect LabEx ( ANR-11-LABX-0048) pour avoir inspiré les développeurs d'événements scientifiques de R/Bioconductor et Ubuntu pour leur logiciel et trois évaluateurs anonymes pour leurs commentaires. Ce travail a été soutenu par le Conseil européen de la recherche dans le cadre de la convention de subvention n° 281359 du septième programme-cadre de l'Union européenne FP7/2007-2013 et par la Fondation ARC pour la recherche sur le cancer.