Informations

Comment les myosines provoquent-elles le raccourcissement des myofibrilles ?


Je sais que c'est la fixation et le basculement des myosines sur les actines qui provoquent le raccourcissement du sarcomère. Mais je suis un peu confus sur les détails. La structure d'un sarcomère est constituée de bandes alternatives de filaments d'actine et de myosine. Ainsi, lorsque l'actine est raccourcie par les filaments de myosine des deux côtés, ne subirait-elle pas des forces dans des directions différentes ? Si oui, pourquoi le sarcomère peut-il être raccourci plutôt que déchiré ? Je suis un peu confus quant à la façon dont le mouvement des myosines provoque la contraction du muscle.


La microscopie à résolution de polarisation révèle un mécanisme indépendant du moteur de la myosine musculaire de l'ordre moléculaire de l'actine pendant la maturation du sarcomère

Affiliations Institute of Neurobiology and Cells-in-Motion Cluster of Excellence (EXC 1003 – CiM), Université de Münster, Münster, Allemagne, Département de zoologie, Université de Colombie-Britannique, Vancouver, Canada

Rôles Curation des données, Investigation, Méthodologie

Affiliation Max Planck Institute of Biochemistry, Muscle Dynamics Group, Martinsried, Allemagne

Rôles Acquisition de financement, Supervision

Affiliation Institute of Neurobiology and Cells-in-Motion Cluster of Excellence (EXC 1003 – CiM), Université de Münster, Münster, Allemagne

Rôles Conceptualisation, Acquisition de financement, Méthodologie, Supervision, Rédaction – ébauche originale, Rédaction – révision et édition

Affiliation Aix Marseille Université, CNRS, Centrale Marseille, Institut Fresnel, Marseille, France

Rôles Conceptualisation, Acquisition de financement, Supervision, Rédaction – ébauche originale, Rédaction – révision et édition

Affiliation Aix Marseille Université, CNRS, IBDM, Marseille, France

Rôles Conceptualisation, Analyse formelle, Acquisition de financement, Supervision, Visualisation, Rédaction – ébauche originale, Rédaction – révision et édition

Affiliations Aix Marseille Université, CNRS, IBDM, Marseille, France, Max Planck Institute of Biochemistry, Muscle Dynamics Group, Martinsried, Allemagne


Résumé

Le muscle squelettique est constitué de faisceaux de myofibres contenant des millions de myofibrilles, chacune étant formée de structures de sarcomères alignées longitudinalement. Les sarcomères sont l'unité contractile minimale, qui se compose principalement de quatre composants : les bandes Z, les filaments minces, les filaments épais et la connectine/titine. La taille et la forme du composant sarcomère sont strictement contrôlées. Étonnamment, les cellules musculaires squelettiques synthétisent non seulement une série de protéines myofibrillaires, mais régulent également l'assemblage de ces protéines dans les structures du sarcomère. Cependant, les structures de sarcomères authentiques ne peuvent pas être reconstituées en combinant des protéines myofibrillaires purifiées in vitro, il doit donc y avoir un mécanisme élaboré assurant la formation correcte de la structure myofibrillaire dans les cellules musculaires squelettiques. Cette revue traite du rôle de la myosine, un composant principal du filament épais, dans la formation du filament épais et de la dynamique de la myosine dans les cellules musculaires squelettiques. Les modifications du nombre de myofibrilles dans les myofibres peuvent provoquer une hypertrophie ou une atrophie musculaire. Par conséquent, il est important de comprendre les mécanismes fondamentaux par lesquels les myofibres contrôlent la formation de myofibrilles au niveau moléculaire pour développer des approches qui améliorent efficacement la croissance musculaire chez les animaux.


Physiologie musculaire et état de la myosine SRX

Myosin RLC régule l'état de la myosine SRX

On sait depuis longtemps que la phosphorylation-déphosphorylation du RLC agit comme un interrupteur binaire « marche »–« arrêt » pour activer l'activité de la myosine des muscles lisses (examiné dans Trivedi et al., 2018). Il existe une forte propension de la myosine musculaire lisse non phosphorylée à se replier vers l'état IHM. Les myosines musculaires striées ne sont pas activées et désactivées de cette manière. Cependant, la phosphorylation RLC est connue pour affiner la fonction de la myosine striée de plusieurs manières différentes (Yu et al., 2016). Les premières études ont montré que la phosphorylation affecte la disposition des têtes de myosine dans les filaments des muscles squelettiques (Levine et al., 1996). Il existe également des preuves d'un dérèglement de la phosphorylation des RLC dans différents modèles d'insuffisance cardiaque et de cœurs de cardiomyopathie dilatés (Huang et al., 2008 van der Velden et al., 2003 Toepfer et al., 2013). Au niveau moléculaire, de multiples découvertes ont conduit à l'hypothèse qu'à l'état détendu du sarcomère du muscle strié, lorsqu'une sous-population de RLC n'est pas phosphorylée, une fraction des têtes de myosine est maintenue sur l'épine dorsale du filament dans laquelle la myosine est considéré comme étant dans l'état IHM (examiné par Craig et Woodhead, 2006 et Alamo et al., 2018). La phosphorylation des RLC provoque ensuite l'association plus lâche de ces myosines avec le squelette du filament facilitant les interactions entre ponts croisés avec l'actine (examiné dans McNamara et al., 2015 et Trivedi et al., 2018), suggérant un réglage fin de la fonction ' et l'état 'off' de la myosine. Qu'est-ce que cela signifie en termes d'équilibre d'état de la myosine DRX↔SRX? La première étude à signaler la capacité de la phosphorylation des RLC à dépeupler l'état de myosine SRX a été réalisée dans les fibres musculaires squelettiques de lapin (Stewart et al., 2010) et reproduite par la suite dans le muscle squelettique de la tarentule (Naber et al., 2011). Une observation similaire a été faite lorsqu'une version phosphomimétique du RLC, S15D, dans le fond mutant R58Q RLC causant HCM, a dépeuplé l'état SRX dans les fibres musculaires papillaires porcines dépouillées (Yadav et al., 2019). Ce rapport est discuté plus en détail dans la section « État pathologique et modulateurs thérapeutiques de l'état de la myosine SRX ». Dans les filaments épais de myosine cardiaque porcine reconstituée de pleine longueur, il a également été récemment rapporté que la phosphorylation du RLC avec MLCK ou l'épuisement du RLC diminue la population de myosine dans l'état SRX (Gollapudi et al., 2020a). Toutes ces observations suggèrent ensemble un changement médié par la phosphorylation RLC dans l'équilibre de l'état DRX↔SRX vers l'état DRX de la myosine. Ce changement vers l'état DRX a été corrélé avec le dépeuplement de l'état IHM structurel lors de la phosphorylation du RLC (Alamo et al., 2016). L'observation que les facteurs qui affectent le RLC affectent également la population de l'état SRX n'est pas surprenant si l'on suppose que l'état IHM est une source majeure de l'état SRX, car les deux RLC se lient l'un à l'autre formant l'une des principales interfaces stabilisatrices. l'État de l'IHM (Alamo et al., 2016).

La chaîne légère essentielle de la myosine peut être essentielle pour l'état de la myosine SRX

Le rôle de la chaîne légère essentielle (ELC) et la façon dont la liaison du Ca 2+ à l'ELC (dans le domaine de régulation du pétoncle contenant deux chaînes légères avec un court fragment de la chaîne lourde) régule la contraction musculaire des mollusques a fait l'objet d'études dans les laboratoires d'Andrew Szent-Gyorgyi et autres (Szent-Györgyi, 1975 Fromherz et Szent-Györgyi, 1995 Chantler, 2006 Trybus, 1994). Il a été démontré que la liaison du Ca 2+ à l'ELC active la myosine de manière enzymatique et structurelle à partir de son état « off » de type IHM (Woodhead et al., 2013). Cependant, le rôle de l'ELC dans le muscle cardiaque, squelettique ou lisse n'est pas bien compris. Plusieurs laboratoires ont démontré qu'une extension spécifique N-terminale de l'ELC peut jouer un rôle essentiel dans la régulation de la fonction motrice de la myosine et la production de force dans le muscle strié (Kazmierczak et al., 2009 Muthu et al., 2011 Guhathakurta et al., 2015) . Récemment, l'hypothèse selon laquelle ce domaine N-terminal de l'ELC cardiaque fonctionne comme un interrupteur de liaison moléculaire de l'interaction actine-myosine en régulant l'équilibre de l'état DRX↔SRX a été testée dans le muscle papillaire de souris conçues pour exprimer un ELC dépourvu de son N. -terminaux 43 acides aminés (Tg-Δ43). L'absence de l'extrémité N-terminale de l'ELC chez la souris a entraîné une augmentation significative de la population de myosine à l'état SRX, diminuant ainsi la proportion de têtes de myosine disponibles pour interagir avec l'actine (Sitbon et al., 2020). En accord, la myosine purifiée à partir de cœurs Tg-Δ43 a montré une utilisation significativement réduite de l'ATP et une faible myosine ATPase activée par l'actine par rapport à celle des cœurs de type sauvage (WT). Bien que les études soient limitées, cette observation postule le rôle de l'ELC dans la régulation de l'état de la myosine SRX et exige plus d'études à l'avenir pour solidifier l'hypothèse. Au total, les deux chaînes légères associées aux myosines striées semblent jouer un rôle déterminant dans le contrôle de la population de myosine à l'état SRX, fonctionnant ainsi comme des commutateurs régulateurs de la contractilité musculaire.

Âge, sexe et régulation hormonale de l'état de la myosine SRX

Dans le muscle squelettique détendu, il a été estimé que

50% des myosines restent à l'état SRX, et le reste est à l'état DRX (Stewart et al., 2010 Cooke, 2011). Il est également connu qu'indépendamment de la taille du muscle ou de la présence de maladies neurologiques ou musculaires, il existe une perte progressive de la force musculaire avec le vieillissement, appelée dynapénie. Une telle altération de la contractilité des muscles squelettiques liée à l'âge est plus importante chez les femmes post-ménopausées que chez les hommes du même groupe d'âge. Par conséquent, il est essentiel de comprendre si le vieillissement et le sexe peuvent modifier l'équilibre de l'état de la myosine DRX↔SRX ou modifier les propriétés de l'état SRX. Cette hypothèse a été testée dans le muscle psoas de souris mâles et femelles C57BL/6 jeunes (3–4 mois) et âgées (26–28 mois), et aucun effet significatif sur la population SRX en fonction de l'âge ou du sexe ( Phung et al., 2018) ont été observées. Cependant, uniquement pour les souris femelles, le temps de cycle ATPase de la myosine dans les états DRX et SRX était significativement plus rapide avec l'âge. On sait que l'œstradiol, une hormone ovarienne, est le signal hormonal clé pour le muscle squelettique chez la femme et que sa carence nuit à la myosine et à la fonction musculaire. Dans une étude antérieure (Colson et al., 2015) du même laboratoire, des expériences de renouvellement unique chez les souris C57BL/6 ovariectomisées ont révélé deux populations distinctes de myosine dans les états SRX et DRX dans une proportion similaire aux populations observées dans le contrôle souris. Cependant, le taux de renouvellement de l'ATP de la population SRX a été significativement augmenté par rapport aux témoins non opératoires. Cet effet a été ramené au contrôle WT par un traitement chronique de 60 jours des souris ovariectomies avec de l'œstradiol, mais pas par un traitement du muscle psoas isolé avec de l'œstradiol, suggérant que la signalisation médiée par l'œstradiol régule de manière réversible le ralentissement du renouvellement de l'ATP par la myosine. Dans l'ensemble, les auteurs de ces études soutiennent que le vieillissement des femmes, qui conduit à un épuisement de l'hormone œstradiol, déplace davantage la myosine musculaire vers un état de type DRX avec un cycle ATP plus rapide. Les auteurs émettent l'hypothèse que cela pourrait entraîner une accumulation de complexes d'actomyosine faiblement liés, pouvant entrer en compétition avec les complexes existants fortement liés, entraînant ainsi un ralentissement de la cinétique des ponts croisés et une faiblesse accrue avec l'âge. Une autre possibilité pourrait être que le passage à davantage de têtes DRX puisse compenser la perte de fibres musculaires plutôt que la cause de la perte de contractilité. Ces études peuvent faire allusion aux différences moléculaires dans les traits musculaires entre les sexes et les groupes d'âge, et de nombreuses autres enquêtes dans cette direction seraient nécessaires pour prouver l'une ou l'autre hypothèse.

Le rôle du calcium dans la régulation de l'état de la myosine SRX

Ca 2+ joue un rôle important dans une variété de processus biologiques dans le corps. L'un de ces processus bien étudié est l'activation de la contraction des muscles squelettiques et cardiaques médiée par la liaison directe de Ca 2+ au complexe de filaments minces régulé par l'actine-tropomyosine-troponine (examiné par Ebashi et Endo, 1968, et Gordon et al., 2000). Comme indiqué précédemment, la liaison du Ca 2+ à la myosine des pétoncles déstabilise la myosine de l'état « off » de type IHM, un mécanisme qui n'a pas été propagé au cours de l'évolution dans le système des vertébrés. Certains premiers travaux des laboratoires de Richard Moss et d'autres ont montré que la sensibilité au Ca 2+ du taux de développement de la force dans le muscle squelettique des vertébrés est en partie médiée par la sous-unité RLC du pont croisé de myosine (Metzger et al., 1989 Metzger et Moss, 1992 Metzger et Moss, 1990 Metzger et Moss, 1991). D'autres études ont proposé l'importance des cations divalents tels que Ca 2+ et Mg 2+ dans la stabilité de l'état de la myosine SRX (Nogara et al., 2016a). Ce n'est que récemment qu'une étude a rapporté que la liaison de Ca 2+ et non de Mg 2+ aux filaments de myosine cardiaques porcins reconstitués a dépeuplé l'état de myosine SRX, proposant ainsi une activation médiée par Ca 2+ du filament épais comme régulation supplémentaire du vertébré musculaire (Sa et al., 2019). La validité de ce mécanisme dans toutes sortes de systèmes squelettiques et cardiaques est débattue (Irving, 2017) et reste un domaine d'investigation actif. Si vraiment, la régulation médiée par le Ca 2+ de la population de myosine SRX tient le coup, ce serait encore un autre moyen évolutif de réguler la contractilité musculaire, en particulier dans le contexte du cœur battant. D'autres études sondant le rôle du Ca 2+ dans la régulation de la myosine sont nécessaires.

L'énergétique musculaire et le rôle de l'ADP dans la régulation de l'état de la myosine SRX

Phénotypiquement, sur la base de propriétés telles que la force contractile et les vitesses, les fibres musculaires squelettiques peuvent être classées comme lentes ou rapides, en fonction des différentes isoformes de myosine qu'elles expriment. Par conséquent, les taux métaboliques et les performances du muscle entier dépendent de la distribution et de la proportion de ces différents types de muscles. Il a été récemment montré que le type de muscle squelettique rapide a une population moindre de myosines dans l'état SRX que le type de muscle lent (Phung et al., 2020), suggérant une consommation d'énergie plus élevée par les types de muscle rapide. Cette consommation d'énergie au repos plus élevée par les fibres musculaires rapides peut contribuer à des différences dans le taux métabolique basal du corps entier et fournir des informations supplémentaires pour comprendre l'énergétique musculaire.

De plus, les dysfonctionnements liés à l'énergie sont à la base de nombreuses maladies courantes, telles que les troubles mitochondriaux, qui ont souvent un impact sur les organes les plus consommateurs d'énergie du corps, tels que les muscles squelettiques et cardiaques, le cerveau, le foie et les reins. Par exemple, dans le contexte de la contractilité cardiaque, des enzymes dépendantes de l'ATP sont nécessaires à la fois pour la systole (par exemple, la myosine) et la diastole (par exemple, SERCA). On a deviné que

60 à 70 % de l'ATP généré dans le muscle cardiaque serait utilisé par les myosines (Barclay, 2015). Par conséquent, toute perte d'énergie chimique conduirait à un cœur défaillant qui ne peut pas répondre aux exigences hémodynamiques du corps. Il est important de noter que la quantité d'ATP produite et utilisée par minute est plusieurs fois supérieure à la taille du pool d'ATP existant, soulignant que le maintien d'un apport élevé en ATP est extrêmement important pour le maintien de la fonction cardiaque. Il est concevable que l'hypercontractilité du cœur due à des maladies telles que la HCM ou aux effets des inotropes puisse perturber le rapport [ADP]/[ATP] et provoquer des déséquilibres métaboliques (Ingwall et Weiss, 2004). Quelques études ont rapporté le rôle de l'ADP dans la manifestation de l'état de la myosine SRX. Par exemple, dans les fibres musculaires squelettiques rapides et lentes du lapin, l'ADP se liant à la myosine attache fortement le moteur de la myosine à l'actine et déplace les protéines régulatrices, activant la fibre. Cette action entraîne une possible dépopulation médiée par la souche de l'état SRX de la myosine et, par conséquent, l'attachement de plus de têtes de myosine à l'actine (Stewart et al., 2010). De même, lors du traitement à l'ADP, des taux de renouvellement de l'état SRX accrus ont également été observés dans les fibres musculaires du psoas de souris (Phung et al., 2018). Ces études suggèrent que le filament épais dans le muscle squelettique, lors de la liaison de la rigueur à l'actine, peut subir une déstabilisation de la population SRX par la contrainte. Un mécanisme similaire a également été observé dans les myosines des myofibrilles squelettiques lentes du soléaire du rat (Nelson et al., 2020). Cependant, Hooijman et al., 2011 ont observé qu'une telle déstabilisation médiée par l'ADP de la population SRX dans le tissu cardiaque est affectée dans une moindre mesure par les états de rigueur-ADP des têtes de myosine adjacentes que ce qui est observé dans les fibres squelettiques. Les auteurs soutiennent que cela pourrait s'expliquer par une nature coopérative beaucoup plus faible des myosines dans le muscle cardiaque par rapport à celles du muscle squelettique. En outre, de nombreux autres facteurs tels que les différences dans les isoformes et les niveaux de phosphorylation d'autres protéines telles que la myosine RLC, MyBPC et la titine pourraient contribuer à ces différences dans la coopérativité de la myosine et constituent un domaine d'investigation ouvert.

De manière très intéressante, dans le muscle squelettique, lorsque le dérèglement médié par l'ADP de l'état de la myosine SRX a été étudié à grande longueur de sarcomère (sans chevauchement actine-myosine), l'ADP n'a pas modifié le nombre de myosines dans la population SRX mais a significativement augmenté le renouvellement de l'ATP. taux de ces myosines, suggérant que la liaison de l'ADP à certaines têtes de myosine augmente le taux de libération de phosphate des têtes adjacentes (Stewart et al., 2010). Récemment, en utilisant de la myosine cardiaque porcine, Gollapudi et al., 2020a ont également montré une déstabilisation médiée par l'ADP de la population SRX de myosine dans des filaments épais de myosine reconstituée, mais pas dans le sous-fragment de myosine S1 ou la méromyosine lourde (HMM), suggérant un relais mécanisme d'une déstabilisation coopérative de la population SRX, via les queues proximale et distale de la myosine dans le filament épais, qui est absent dans les constructions de myosine plus courtes. Ces études sont cohérentes avec l'observation selon laquelle la liaison de l'ADP produit une configuration ouverte de myosine et perturbe l'ordre hélicoïdal du filament épais dans une fibre musculaire du psoas de lapin surchargée (Xu et al., 2003). Tous ces résultats ensemble suggèrent le mécanisme coopératif du filament épais où une myosine liée à l'ADP (et donc peu susceptible d'être dans l'état SRX) peut structurellement et fonctionnellement diminuer la population d'autres myosines dans l'état SRX (celles qui ont encore n'a pas perdu son phosphate), transformant ainsi éventuellement les têtes de myosine adjacentes vers un état « on » plus désordonné. Ces observations peuvent suggérer que dans de nombreux troubles métaboliques musculaires, y compris dans la HCM, où il y a une accumulation d'ADP dans le corps, les myosines seraient davantage à l'état actif de type DRX, consommant ainsi encore plus d'énergie que d'habitude, exacerbant ainsi l'effet. .

Température : augmenter la chaleur pour stabiliser la population de myosine SRX

La température joue un rôle vital en dictant la dynamique de presque tous les processus biologiques dans le corps, et il n'est pas surprenant que la température affecte l'équilibre de l'état de la myosine DRX↔SRX.Par exemple, dans le muscle squelettique, une température plus élevée induit une proportion plus élevée de têtes de myosine dans l'état SRX et ralentit le temps de renouvellement de l'ATP pour ces myosines (Stewart et al., 2010), probablement en peuplant la myosine dans l'ADP avant l'AVC. État Pi. De nombreuses études dépendantes de la température surveillant la conformation de la myosine ont également confirmé la formation de plus de myosines dans l'état structurel « off » et la stabilisation de la structure hélicoïdale ordonnée du filament épais avec une augmentation de la température (Xu et al., 2003 Fusi et al., 2015 Caremani et al., 2019). Ce n'est pas surprenant. En raison de l'effet hydrophobe, la plupart des interactions protéine-protéine sont plus fortes à des températures plus élevées. Cependant, dans un système de myosine cardiaque bovine purifiée, Rohde et al., 2018 ont observé qu'avec l'augmentation de la température, la fraction de myosine à l'état SRX diminuait dans un système S1 et n'avait aucun effet dans le système HMM, contrairement à ce qui a été observé par l'étude précédente de Stewart et al., 2010 dans les fibres musculaires squelettiques. Ensemble, ces observations suggèrent que le réseau d'interactions moléculaires qui régissent l'état SRX dans un système de fibres musculaires plus compliqué est différent de celui d'un système HMM ou S1 purifié, ce qui peut donner lieu à différentes dépendances de température dans différents systèmes. Il existe également une possibilité d'une différence inhérente entre la population d'états SRX dans les systèmes musculaires squelettiques et cardiaques (Hooijman et al., 2011). Une étude des changements dans la population de myosine SRX avec des changements de température utilisant différents types de muscles de divers animaux à sang froid et à sang chaud permettrait de mieux comprendre les interactions moléculaires qui régulent la formation de l'état SRX et pourrait nous aider à comprendre la dynamique musculaire en hibernation animaux.

L'ancillaire MyBPC et son rôle dans la stabilisation de la population de myosine SRX

MyBPC est une protéine multidomaine associée aux filaments épais dans le muscle squelettique et cardiaque connue pour moduler la cinétique des ponts croisés via la phosphorylation des résidus de sérine dans le soi-disant domaine M. L'extrémité C de MyBPC se lie au filament épais et l'extrémité N peut interagir à la fois avec la tête de myosine et le filament d'actine. Plusieurs études examinées dans McNamara et al., 2015 et Trivedi et al., 2018 ont suggéré un rôle de MyBPC dans la stabilisation des têtes de myosine près du filament épais de myosine dans un « état désactivé » de type IHM, et la phosphorylation du M- les résidus de sérine du domaine déplacent davantage l'équilibre vers un « état actif » désordonné. Comment cela est-il corrélé avec l'équilibre d'état de la myosine DRX↔SRX? Il a été rapporté pour la première fois dans une étude avec des fibres musculaires cardiaques écorchées que les souris knock-out MyBPC homozygotes mais non hétérozygotes présentaient une diminution significative de la population de myosine dans l'état SRX par rapport à WT (McNamara et al., 2016). Conformément à cette observation descendante, une approche ascendante avec de la myosine β-cardiaque humaine purifiée a récemment démontré que la population de myosine à l'état SRX augmentait en présence du fragment C0-C7 MyBPC (Sarkar et al., 2020) . Ces deux études suggèrent que MyBPC augmente la population de la myosine à l'état SRX. Ce travail est discuté plus en détail dans la section « Les mutations causant l'HCM et autres dans la myosine dérèglent l'état de la myosine SRX ».

Dans une autre étude sur la souris (McNamara et al., 2019), il a en outre été démontré que dans une version triple phosphomimétique de MyBPC cardiaque (modifications de la sérine DDD → aspartate au niveau des résidus 273, 282 et 302 du domaine M de MyBPC), le la population de myosine SRX a significativement diminué par rapport aux versions WT et triple phospho-ablation de MyBPC (changements AAA sérine → alanine aux résidus 273, 282 et 302). Lors d'une enquête plus approfondie sur les phosphorylations spécifiques au site, les auteurs ont montré qu'une version phosphomimétique du site ser 282 (changement ADA sérine → aspartate au résidu 282 et changements sérine → alanine aux résidus 273 et 302) était suffisante pour déplacer le DRX↔ Équilibre de l'état SRX vers l'état DRX de la myosine. Il est intéressant de noter que la version phosphomimétique inverse (changements DAD sérine → aspartate aux résidus 273 et 302, et changement sérine → alanine aux sites des résidus 282) n'a pas affecté l'équilibre de l'état de la myosine DRX↔SRX. Comme les études précédentes, le traitement des préparations WT avec la protéine kinase A a réduit la myosine dans l'état SRX. En revanche, il n'y a eu aucun effet dans la version phospho-ablée des préparations MyBPC, renforçant l'hypothèse selon laquelle la phosphorylation de MyBPC joue un rôle régulateur en faisant passer la myosine d'un état fonctionnel « off » à un état plus fonctionnel « on ».

Compte tenu du fait que MyBPC se localise dans la zone C du sarcomère, un rapport récent a utilisé une imagerie fluorescente à molécule unique de myofibrilles squelettiques soléaires de rat dans des conditions détendues pour mesurer la cinétique de l'hydrolyse de l'ATP dans différentes régions du sarcomère (Nelson et al. , 2020). Les auteurs ont résolu spatialement l'hydrolyse de molécules d'ATP marquées par fluorescence par des myosines dans la zone C, la zone D et la zone P. Les zones D et P sont des zones du filament épais vers les lignes Z et M, respectivement, et sont dépourvues de MyBPC. Les durées de vie de la myosine ATPase dans la zone C étaient significativement plus longues que celles des régions flanquantes ne contenant pas de MyBPC. De plus, dans la zone C, deux populations différentes de myosine correspondant aux états DRX et SRX ont été observées, tandis que dans les régions ne contenant pas de MyBPC, toutes les myosines étaient principalement à l'état DRX, ce qui suggère que les myosines SRX fortement inhibées existent principalement dans la zone C du sarcomère squelettique. Toutes ces observations ensemble construisent une histoire où la liaison de MyBPC aux myosines dans la zone C du sarcomère strié peuple l'état SRX, et la phosphorylation de MyBPC déplace cet équilibre davantage vers l'état DRX. Cette observation correspond à la régulation structurelle des filaments épais du muscle par MyBPC (revue dans McNamara et al., 2015 et Trivedi et al., 2018) et ajoute MyBPC comme un contributeur essentiel qui a évolué dans le muscle strié pour affiner contractilité de la myosine indirectement.

Sous-fragment de myosine 2 : la queue raconte une histoire sur l'état de la myosine SRX

Comme décrit ci-dessus, et dès 2008, un état structurel replié de la myosine, appelé IHM, a été découvert (examiné dans Trivedi et al., 2018 et Alamo et al., 2018), où les deux têtes S1 de la myosine replier de manière asymétrique sur la queue S2. De plus, au niveau moléculaire, il a été démontré que la tête S1 interagit avec la partie proximale du S2 de manière biochimique (Nag et al., 2017). De nombreuses autres interactions, telles que les S1-S1 et RLC-RLC des deux têtes de myosine, sont proposées pour stabiliser l'état de l'IHM. Cependant, à partir d'études en microscopie électronique, il est évident que les interactions S1-S2 sont nécessaires pour former l'état structurel « off » de la myosine. Ce sous-fragment S2 de la myosine modifie-t-il également l'équilibre de l'état DRX↔SRX de la myosine ? Cette question a été abordée récemment dans un rapport où deux versions différentes de HMM β-cardiaque humain ont été faites. L'un contenait les 25 premiers heptades de la partie proximale du sous-fragment S2 (25-hep), et l'autre ne contenait que les deux premières répétitions heptadiques du sous-fragment S2 (2-hep). Dans des expériences d'ATP à renouvellement unique, le HMM 25-hep a montré une stabilisation significative de la population de myosine SRX à

60%. En revanche, la population SRX dans le HMM 2-hep était

20%, suggérant que le sous-fragment proximal S2 de la myosine déplace l'équilibre de l'état DRX↔SRX de la myosine vers l'état SRX. Indépendamment, une conclusion similaire a également été tirée par Rohde et al., 2018 lors de l'étude de la population SRX dans les cœurs bovins S1 et HMM. Il a également été démontré que le sous-fragment S2 de la myosine se lie à l'extrémité N-terminale du MyBPC (Gruen et Gautel, 1999) (examiné dans Trivedi et al., 2018). Dans une autre étude, une concentration élevée de S2 proximal ajoutée aux fibres du muscle cardiaque ventriculaire de souris a considérablement réduit le nombre de têtes de myosine dans l'état SRX (McNamara et al., 2019). Cet effet a également été observé dans la version triple phospho-ablation de MyBPC (changements AAA sérine → alanine aux résidus 273, 282 et 302 dans le domaine M de MyBPC) (McNamara et al., 2019). Ces observations suggèrent que S2 exogène peut pousser l'équilibre de l'état DRX↔SRX vers l'état DRX de la myosine, très probablement par la perturbation de l'interaction MyBPC-myosine, ce qui signifie davantage le rôle physiologique du sous-fragment myosine 2 (myosine S2) pour peupler l'état SRX . Pendant longtemps, en biologie des muscles striés, on a pensé que le fragment de myosine S2 ainsi que le domaine de la queue fournissaient une stabilité structurelle et un rôle d'ancrage passif à la myosine dans le filament épais. Cependant, ces études biochimiques ont commencé à mettre en évidence qu'un domaine de la myosine tel que le S2, qui est éloigné du site enzymatique de la protéine, peut réguler la contractilité musculaire en contrôlant la population de myosines à l'état SRX, fournissant ainsi un commutateur évolutif supplémentaire. pour la contractilité musculaire.


Qu'est-ce qui fait que les muscles se contractent ?

Le processus de contraction musculaire se déroule dans les filaments protéiques du sarcomère.

Explication:

Généralement, les muscles bougent
par un processus appelé contraction qui provoque le raccourcissement du ventre musculaire. Les muscles travaillent en opposition. Le muscle qui se contracte est appelé agoniste, tandis que celui qui se détend est appelé antagoniste. Le ventre musculaire est composé de faisceaux de muscles
fibres appelées fascicules. Ce sont les fibres musculaires qui sont composées de myofibrilles> qui se contractent en fait grâce à des unités spécialisées appelées sarcomères.

Un sarcomère va de la ligne z à la ligne z. Et est composé d'un filament épais appelé myosine et d'un filament mince appelé actine. Lorsque l'énergie est libérée sous forme d'ATP, le filament épais appelé myosine tourne très rapidement et tire sur les deux protéines présentes sur le mince filament d'actine. Ces deux protéines sont appelées tropomyosine et troponine.

Lorsque cela se produit, les lignes z sont rapprochées et le sarcomère se contracte. Ceci est mieux connu sous le nom de théorie du filament glissant.

Lorsque le sarcomère se contracte, tous les sarcomères se contractent et la myofibrille se contracte. Puis la fibre se contracte et le fascicule et enfin, le ventre se contracte. Lorsque le ventre se contracte, il tire sur le tendon qui à son tour tire sur l'os pour faire bouger le squelette.


Quelles sont les étapes impliquées dans le powerstroke de la myosine?

Chaque protéine motrice de la myosine possède une activité ATPase et fonctionne de manière cyclique qui couple la liaison et l'hydrolyse de l'ATP à un changement de conformation de la protéine. Ce processus est connu sous le nom de &lsquopowerstroke cycle&rsquo (examiné dans [1] [2] [3] ) et est décrit dans les étapes ci-dessous en utilisant la myosine II comme exemple. T

Le mécanisme &ldquopower stroke&rdquo pour le mouvement de la myosine le long des filaments d'actine :

La direction dans laquelle le filament d'actine sera déplacé est dictée par l'orientation structurelle de la myosine par rapport au filament. Un cycle complet d'hydrolyse de l'ATP produit un seul &lsquostep&rsquo ou mouvement de myosine le long du filament d'actine. Ce processus est régulé par des changements dans la concentration de calcium libre intracellulaire (examiné dans [4] ). Les étapes impliquées sont détaillées ci-dessous :

Étape 1 : À la fin du cycle de mouvement précédent et au début du cycle suivant, la tête de myosine est dépourvue d'ATP lié et elle est attachée au filament d'actine dans une conformation de très courte durée connue sous le nom de « conformation lsquorigor ».

Étape 2 : la liaison de l'ATP au domaine de la tête de myosine induit un petit changement de conformation dans le site de liaison à l'actine qui réduit son affinité pour l'actine et provoque la libération du filament d'actine par la tête de myosine.

Étape 3: La liaison ATP provoque également un grand changement de conformation dans le "bras de levier" de la myosine qui plie la tête de la myosine dans une position plus éloignée le long du filament. L'ATP est ensuite hydrolysé, laissant le phosphate inorganique et l'ADP liés à la myosine.

Étape 4 : La tête de myosine est faiblement en contact avec le filament d'actine et un léger changement de conformation se produit sur la myosine qui favorise la libération du phosphate inorganique.

Étape 5 : La libération de phosphate inorganique renforce l'interaction de liaison entre la myosine et l'actine et déclenche par la suite le &lsquopower stroke&rsquo. Le coup de puissance est l'étape génératrice de force clé utilisée par les protéines motrices de la myosine. Des forces sont générées sur le filament d'actine lorsque la protéine myosine revient à sa conformation d'origine.

Étape 6 : Au fur et à mesure que la myosine retrouve sa conformation d'origine, l'ADP est libéré, mais la tête de myosine reste étroitement liée au filament à une nouvelle position d'où elle a commencé, ramenant ainsi le cycle au début.


Matériel et méthodes

Stock de poisson

Les poissons ont été élevés et élevés comme décrit précédemment [71]. Les allèles mutants suivants ont été utilisés : unc45b sb60 [1], amadouer corriger [28], hsp90aa1.1 tu44c/tu44c , [9] smyd1b zf340/zf340 [13], mal sb55 [29], et herzschlag (bonjour tg287 ) [72].

Clonage

unc45b les séquences régulatrices ont été clonées dans le vecteur décrit dans [32] correspondant au pT2KXIGΔin modifié [73], en amont de la protéine fluorescente monomérique Teal 1 (mTFP1). Pour le clonage gata2 basés sur des constructions de rapporteurs, le unc45b des fragments ont été insérés devant le gata2 promoteur [33] entraînant l'expression de gfp par clonage de passerelle [34]. unc45b les séquences en amont ont été amplifiées et clonées en suivant des procédures standard. Les détails sont disponibles sur demande.

Un ADNc complet codant pour le poisson zèbre hsf1 (IRBOp991H0894D, Imagene) a été amplifié (amorces disponibles sur demande). Le produit PCR résultant a été cloné dans un vecteur contenant 3,3 kb unc45b séquence régulatrice en amont et dans le cadre de la protéine fluorescente orange monomère 1 (mOrange1) [74]. Les sites de liaison TF ont été identifiés avec Genomatix.

Western blot

La protéine a été extraite par homogénéisation des embryons déyolvés et séparée par SDS-PAGE à 10 %, transférée sur un filtre de nitrocellulose et incubée avec différents anticorps primaires (1:100 F59 DSHB et 1:100 γ-tubuline, Sigma]) pendant une nuit à 4°C. Après trois lavages, un anticorps secondaire (chèvre anti-souris Alexa Fluor 680, Invitrogen) a été appliqué pendant 1 h à température ambiante. Les transferts ont été visualisés à l'aide d'un système d'imagerie infrarouge (Odyssey LI-COR Biosciences).

Micro-injection

La micro-injection a été effectuée comme décrit [75], brièvement, 1,5 à 2 nl de solution d'injection contenant 20 ng/μl d'ADN plasmidique rapporteur et 15 ng/μl d'ARNm de transposase Tol2, complété par 0,1 % de rouge de phénol (marqueur d'injection), a été injecté dans œufs de poisson zèbre à l'aide d'un micro-injecteur FemtoJet (Eppendorf).

Des morpholinos (Genetools LLC, Oregon) ont été injectés comme suit : 0,3 mM unc45b-mo (CCAATTTCTCCCATCGTCATTGAAG) [1] 0,1 mM hsp90a-mo (TCGAG TGGTTTATTCTGAGAGTTTC) [9] 0,3 mM smyd1b-mo (AAAAACTTCCAC AAACTCCATTCTG) [13] 0,3 mM hsf1-mo (CACGGAGAGTTTAGT GATGATTTCT) [51] 0,3 mM hsf1cont-mo (CACGCACAGTTTACTGATCAT TTGT) 0,3 mM hsf2-Mo (GACGTTCGA GCTGTGTTTCATTTTG) [51] et 0,4 mM titin-Mo (GTGGAAGACCGG TAAGATTACATCT) [77, 76].

Hybridation et imagerie in situ

L'hybridation in situ en montage entier a été réalisée comme décrit [77]. Une sonde antisens liée a été révélée avec de la phosphatase alcaline anti-DIG (Roche). Les sondes pour mef2d, myoD, atf3, vgll2b, SRFl, klhl31, kbtbd10b, comme du kelch, garniture55b, mef2a, nr4a1, smyd1a, crip2, fhl2a5, sarcosine6 et garniture55a ont été obtenus à partir de [43] et pour unc45b, smyd1b, et hsp90a de [1, 13].

Toutes les images ont été prises avec un microscope Leica (MZ16F) et une caméra Leica (DFC320). L'intensité GFP et TPF a été mesurée avec ImageJ (http://imagej.nih.gov/ij/).

Analyse ARN-Seq

Des pools de 20 à 50 embryons de poisson zèbre avec des embryons de type sauvage ou unc45b les phénotypes mutants ont été collectés à 24, 48 et 72 hpf à partir de deux couvées indépendantes. L'extraction de l'ARN total a été réalisée avec du Trizol (Invitrogen) selon le protocole du fabricant. Les échantillons d'ARN total extraits ont été testés sur des nanopuces à ARN (Bioanalyser 2100, Agilent) et n'ont montré aucun signe de dégradation (nombre d'indice d'ARN > 9). Des bibliothèques de séquençage ont été générées à partir de 1 g d'échantillons d'ARN avec le kit TruSeq mRNA v.2 (Illumina). La taille et la concentration des banques de séquençage ont été déterminées avec une puce à ADN (Bioanalyser 2100, Agilent) et les concentrations ajustées à 7 pM. Des échantillons multiplexés ont été chargés sur un nombre total de trois voies de séquençage. Des lectures d'extrémités appariées (2 × 50 nucléotides) ont été obtenues sur un Hiseq1000 en utilisant des kits SBS v3 (Illumina).

La détection de cluster et l'appel de base ont été effectués à l'aide de RTA v.1.13 et la qualité des lectures évaluée avec CASAVA v.1.8.1 (Illumina). Le séquençage a donné 302 millions de paires de lectures de 50 nucléotides avec un score de qualité Phred moyen > 35 (Fichier supplémentaire 1). Les lectures ont été mappées sur le génome du poisson zèbre (Zv9) en utilisant TopHat version 1.4.1 [78] avec les options --butterfly-search --coverage-search --microexon-search -a 5 -p 5 --library-type fr -non brin et utilisant des jonctions d'exons connues (Ensembl release 75). La distance moyenne et l'écart type entre les paires de lecture ont été obtenus à partir de CASAVA. L'expression génique a été déterminée avec HTSeq version 0.5.3p3 [79] en comptant pour chaque gène le nombre de lectures qui chevauchaient l'emplacement d'annotation obtenu à partir de la version 75 d'Ensembl. L'expression différentielle a été calculée en utilisant le R paquet DESeq [79]. Gènes avec 1,5 fois le changement (augmentation ou diminution) et ajusté p valeur (FDR) inférieure à 0,05 ont été considérés comme exprimés différentiellement. Le regroupement hiérarchique a été effectué dans R avec le gplots package sur un ensemble de gènes sélectionnés exprimés de manière différentielle dans au moins une condition avec la corrélation de Pearson et la méthode de liaison complète, en utilisant des données d'expression à variance stabilisée. Le clustering flou a été réalisé sur un ensemble de 1825 gènes mal régulés dans au moins une condition (FDR < 0,05) en utilisant les paramètres c = 6 et m = 1,25 [80].

Les données transcriptomiques de la mal et hsp90a−/− les mutants et les frères et sœurs de type sauvage correspondants à 72 hpf ont été générés comme décrit précédemment sur deux voies de 2 × 50 pb en double ou en triple (330 millions de paires de lecture), et alignés sur le génome de référence comme précédemment avec TopHat (Fichier supplémentaire 1) . Les données de unc45b, mal et hsp90a les mutants à 72 hpf ont été analysés avec DESeq2, qui ont une meilleure puissance d'analyse par rapport à DESeq et détectent ainsi plus de gènes mal exprimés. La robustesse des réplicats biologiques est indiquée sur la carte thermique des distances euclidiennes de la figure S1a dans le fichier supplémentaire 2 (panneau de droite). Au niveau mondial, l'analyse des unc45b les données à 72 hpf par DESeq et DESeq2 sont bien corrélées, avec un coefficient de corrélation de Pearson du changement log2 fois r = 0,82, montrant la similitude entre les deux méthodes.

Des études d'enrichissement à terme GO ont été réalisées sur des clusters de gènes obtenus par clustering à l'aide de Metacore (Thomson Reuters) ou en calculant p valeurs du test exact de Fisher. À cette fin, des orthologues humains ont été obtenus à partir de l'Ensembl Compara pour interroger les termes GO et traiter les voies considérablement enrichies dans les différents clusters. Pour le balayage des sites de liaison du TF dans les gènes obtenus par clustering moyen flou, des promoteurs comprenant -1 kb par rapport au site de démarrage de la transcription ont été analysés par Opossum [81] et Pscan [82]. Des orthologues humains pour chaque groupe ont été obtenus à partir de Biomart et une séquence de -1 kb à partir du site de démarrage de la transcription balayé comme précédemment. Pour rechercher le site de liaison Hsf1 dans les séquences régulatrices des 88 TF régulés positivement (FDR < 0,1 et changement de pli > 1,5), -1 kb à +1 kb du site de démarrage de la transcription a été scanné avec Opposum v.3.0. P les valeurs ont été calculées à partir des scores Z bruts obtenus à partir d'Opposum (p < 10 -20 et Z-score > 10 ont été considérés comme significatifs).

Approbation éthique

Les expériences sur les animaux ont été réalisées conformément aux normes allemandes de protection des animaux et ont été approuvées par le gouvernement du Bade-Wurtemberg, Regierungspräsidium Karlsruhe, Allemagne (Aktenzeichen 35-9185.81/G-137/10").


Revoir

Introduction

Les myosines sarcomériques présentes dans le muscle strié des mammifères sont des myosines de classe II ou conventionnelles, chaque molécule de myosine étant constituée de deux chaînes lourdes (MyHC), de deux chaînes légères essentielles (MLC) et de deux MLC régulatrices. Les MyHC et les MLC sont tous deux présents sous différentes isoformes codées par différents gènes. Un total de 11 MyHCs est codé par 6 chaînes lourdes de myosine (MON H) gènes largement exprimés dans les muscles du corps et 5 autres gènes à expression limitée dans les muscles squelettiques spécialisés. Cinq MLC essentielles sont codées par quatre chaînes légères de myosine (MYL) gènes, et deux MLC régulatrices par deux autres MYL gènes (tableau 1) (voir [1]). La plupart de ces gènes sont également exprimés dans le muscle squelettique en développement, y compris deux isoformes MyHC, appelées myosines embryonnaires et néonatales (ou périnatales), codées par MYH3 et MYH8, respectivement, et la chaîne légère de myosine 1 embryonnaire/auriculaire, codée par le MYL4 gène, qui sont présents à des niveaux élevés dans les premiers stades du développement musculaire, sont régulés à la baisse après la naissance et sont réexprimés pendant la régénération musculaire. Ici, nous passons en revue le modèle d'expression des gènes de la myosine au cours du développement musculaire, en nous concentrant en particulier sur les MyHC embryonnaires et néonatales. De plus, nous discutons des pathologies humaines dues à la mutation de MYH3 et MYH8 et la question non résolue de la signification fonctionnelle de ces myosines.

Identification des myosines développementales dans le muscle squelettique des mammifères

Un certain nombre d'études dans les années 1960 et 1970 ont rapporté des preuves biochimiques suggérant que les myosines isolées du muscle squelettique embryonnaire ou fœtal de mammifère diffèrent des myosines musculaires adultes (voir les références dans [2, 3]). Cependant, Whalen et al. [2] ont été les premiers à fournir des preuves sans ambiguïté de l'existence de myosines développementales distinctes. Ils ont identifié deux MyHC spécifiques, appelées MyHC embryonnaires et néonatales (également appelées périnatales), ci-après appelées MyHC-emb et MyHC-neo, qui précèdent l'apparition des myosines rapides adultes dans le muscle squelettique du rat en développement [2]. Le correspondant MON H les gènes ont été identifiés [4, 5] et se sont avérés être situés dans le même locus chromosomique que le gène codant pour les chaînes lourdes de la myosine rapide adulte sur le chromosome 11 (souris) ou 17 (humain) [6]. Le gène codant pour MyHC-neo (MYH8) montre une similitude de séquence considérable avec les adultes rapides MON H tandis que le gène codant pour MyHC-emb (MYH3) est assez différent (voir [7] pour une analyse de séquence comparative de MON H gènes). Les muscles squelettiques embryonnaires contiennent également un type unique de MLC essentiel, MLC-1emb, codé par le MYL4 gène, qui est également exprimé dans le cœur en développement et dans le myocarde auriculaire adulte mais pas dans le muscle squelettique adulte [8, 9].

Myosines développementales chez d'autres vertébrés

Les myosines développementales sont également présentes chez d'autres vertébrés, tels que les oiseaux et les poissons, bien que les familles de gènes de la myosine sarcomérique soient encore incomplètement caractérisées chez ces espèces. L'identification des myosines développementales chez les poissons est compliquée par le grand nombre de gènes de myosine, résultant de la duplication du génome entier [10]. Dans l'embryon de poisson zèbre, la diversification des lignées cellulaires musculaires rapides et lentes se produit très tôt dans le développement, sous le contrôle de voies de signalisation spécifiques, conduisant à la spécification régionale de différentes isoformes MyHC rapides et lentes. Trois gènes de myosine de type lent, smyhc1, smyhc2, et smyhc3, qui forment un réseau en tandem dans le génome, présentent des modèles d'expression différentiels, les fibres lentes primaires exprimant principalement smyhc1 et des fibres lentes secondaires, qui se forment plus tard dans le développement, exprimant smyhc2 et smyhc3 [11]. Six gènes de myosine de type rapide, disposés en triples répétitions situées dans une région étroite sur les brins opposés du chromosome 5, présentent également des modèles d'expression distincts dans l'embryon de poisson zèbre : les gènes du groupe 1 (fmyhc1.1, fmyhc1.2, et fmyhc1.3) sont exclus de la queue et de la majorité du muscle crânien, alors que les gènes du groupe 2 (fmyhc2.1, fmyhc2.2, et fmyhc2.3) sont fortement exprimés dans les muscles crâniens [12].

Chez les oiseaux, trois MyHC embryonnaires et un néonatal ont été identifiés dans le développement des muscles squelettiques (revue par [13]). De plus, le myotome et les muscles en développement de l'embryon de poulet contiennent trois MyHC de type lent, appelés SM1 (ou MyHC1), SM2 (ou MyHC2) et SM3 (ou MyHC3), SM3 étant également exprimé dans le myocarde auriculaire. 13, 14]. La MyHC ventriculaire est également exprimée de manière transitoire dans les muscles squelettiques du poulet embryonnaire et est réexprimée lors de la régénération musculaire [14]. L'expression des MyHC de type lent se produit dans des muscles squelettiques spécifiques indépendamment de l'innervation, en raison de l'existence de lignées distinctes de précurseurs myogéniques (voir [15]). Le passage des isoformes développementales aux isoformes adultes varie également dans différents muscles de poulet : un passage complet de MyHC rapide embryonnaire/néonatale à adulte se produit dans le muscle pectoral, mais la plupart des autres muscles contiennent des isoformes embryonnaires/néonatales comme composants majeurs tout au long des stades adultes [13 ].

Myosines embryonnaires et néonatales au cours du développement musculaire du rat et de la souris

Les myosines embryonnaires et néonatales ont été particulièrement bien caractérisées dans le développement des muscles squelettiques du rat et de la souris. Les transcrits MyHC-emb et MyHC-neo ont été détectés par hybridation in situ dans les premiers stades de développement : dans l'embryon de souris, MyHC-emb est détecté pour la première fois à 9,5 jours après le coït (E9.5) et MyHC-neo à E10.5 [16]. La régulation positive de ces gènes est apparemment contrôlée par l'activité des facteurs régulateurs myogéniques MyoD et Myf5, impliqués dans l'engagement et la différenciation musculaires, car les promoteurs proximaux des gènes de développement de la myosine contiennent des E-boxes répondant à MyoD et Myf5 [17, 18]. Les muscles squelettiques en développement expriment également une myosine impossible à distinguer de la MyHC-slow adulte, codée par MYH7, tel que déterminé par des analyses au niveau des protéines et des transcrits [19]. Sur la base du profil de réactivité d'un certain nombre d'anticorps anti-myosine, il a été suggéré que les isoformes de MyHC de type lent présentes dans les muscles embryonnaires sont en fait différentes de celles présentes dans le muscle squelettique adulte [20] cependant, cette interprétation n'a pas été confirmée. Il a également été suggéré que le MyHC à tonique lent, identifié pour la première fois dans les muscles extraoculaires et les fibres intrafusales des fuseaux musculaires des muscles adultes [21] et récemment trouvé codé par le MYH7b [22], est une isoforme à développement lent largement exprimée dans la plupart des muscles embryonnaires [23]. Cependant, MYH7b les transcrits sont présents à des niveaux très faibles dans le muscle embryonnaire de souris à E12, et la protéine MYH7b n'est pas détectée dans le muscle embryonnaire et fœtal à l'aide d'un anticorps polyclonal spécifique du domaine N-terminal de MYH7b, à l'exception de fibres rares, identifiées pour la première fois autour de E20, destinées pour devenir les fibres sac des fuseaux musculaires (voir [22]). En conclusion, les preuves disponibles indiquent que trois MyHC sont présents au niveau des protéines dans le muscle squelettique du rat et de la souris en développement : MyHC-emb (MYH3), MyHC-neo (MYH8) et MyHC-slow (MYH7). Des études immunohistochimiques ont montré que le schéma d'expression des myosines développementales varie dans les fibres formées à différents stades de développement. Dans les fibres de génération primaire de rat, MyHC-emb est co-exprimé avec MyHC-slow [19, 24], tandis que les fibres de génération secondaire expriment les MyHC embryonnaires et néonatales [25]. Aux derniers stades fœtaux, un certain nombre de fibres de génération primaire ont tendance à perdre MyHC-slow et à acquérir une réactivité MyHC-neo, tandis qu'un certain nombre de fibres de génération secondaire dans les muscles lents se colorent également pour MyHC-slow [25].

L'activation du gène MyHC au cours de la myogenèse embryonnaire s'accompagne d'une régulation à la hausse parallèle des MLC et d'autres gènes de protéines contractiles. Des études d'hybridation in situ ont montré que les transcrits de MLC-1emb (MYL4) sont exprimés avec MLC-1fast (le principal produit d'épissage du MYL1 gène) commençant dans les premiers stades de développement dans le muscle squelettique embryonnaire de souris, leurs niveaux relatifs sont similaires à E12,5 mais MLC-1fast devient prédominant à E15,5 [16]. MLC-2fast (MYL3) sont également présents au début de l'embryogenèse chez la souris, avec des modèles d'expression temporels et spatiaux variables dans différents groupes musculaires [26]. En revanche, les transcriptions pour MLC-1slow/ventriculaire (MYL4) et MLC-3fast (un autre produit d'épissage de la MYL1 gène) ne sont pas détectables dans les muscles en développement avant E15 [16].

Commutateur de myosine embryonnaire/néonatale à adulte

Les myosines développementales disparaissent dans la plupart des muscles squelettiques au cours du développement postnatal précoce en même temps que la régulation positive des myosines rapides adultes. Dans les muscles squelettiques des pattes de rat, les transcriptions des MyHC adultes rapides (MyHC-2A, MyHC-2X et MyHC-2B, codées par MYH2, MYH1, et MYH4, respectivement) sont d'abord détectés quelques jours après la naissance par hybridation in situ et deviennent prédominants au cours des semaines suivantes [27]. Ce changement se produit plus tôt dans les muscles squelettiques de la souris, car de petites quantités de transcrits de myosine rapide adultes peuvent être détectées avant même la naissance à l'aide de tests de protection sensibles à l'ARNase et par hybridation in situ [28]. Cependant, au niveau protéique, les muscles rapides des souris nouveau-nés contiennent essentiellement du MyHC-neo (environ 70 %) et du MyHC-emb (environ 30 %) avec des traces de MyHC-slow, comme déterminé par électrophorèse sur gel à haute résolution [29]. Le moment de la régulation négative de la myosine embryonnaire et néonatale et de la régulation positive rapide de la myosine chez l'adulte montre une variation significative entre les muscles du corps, à la fois au niveau de l'ARNm [28] et des protéines [29]. L'élimination de la myosine développementale peut également varier au sein d'un même muscle, par exemple, la myosine néonatale s'est avérée persister plus longtemps dans les fibres de type 2A pendant le développement postnatal [30]. Il est intéressant de noter que le moment de la régulation à la baisse des isoformes développementales de MyHC était essentiellement inchangé dans MYH4 (2B) et MYH1 (2X) souris nulles [31].

Le passage des MyHC rapides de développement aux adultes observés dans les muscles rapides des rongeurs a également lieu dans les cellules musculaires en culture. Il a été rapporté que les cellules musculaires C2C12, lorsqu'elles sont induites à se différencier lors du transfert dans un milieu à faible teneur en sérum, expriment d'abord les transcrits MyHC-emb, MyHC-neo et MyHC-slow, commençant au jour 1 et atteignant un pic au jour 2-4 puis diminuant, tandis que les transcrits MyHC-2A, MyHC-2X et MyHC-2B commencent à augmenter au jour 2-4 et atteignent un pic au jour 8 (le dernier moment examiné) [32]. Cependant, il existe des résultats controversés concernant le modèle d'expression de MyHC dans les cultures de cellules satellites de différents muscles squelettiques (voir [33, 34]), et la chaîne lourde de myosine spécifique à la mastication (Myh16) a été détectée dans des cultures de muscle de mâchoire de chat mais pas de muscle de membre. , suggérant que les cellules musculaires des muscles de fermeture de la mâchoire sont préprogrammées pour exprimer ces isoformes au cours de la myogenèse in vitro [35].

Le passage du développement des MyHC développementaux aux MyHC adultes peut être modulé par des influences hormonales et neuronales extrinsèques. Le passage de la myosine rapide embryonnaire/néonatale à l'adulte est sous le contrôle d'une hormone thyroïdienne, l'hyperthyroïdie induisant une expression précoce de l'ARNm de la chaîne lourde de la myosine rapide adulte et l'hypothyroïdie induisant un retard de cette commutation [36-38]. En revanche, l'activité nerveuse n'est apparemment pas nécessaire pour le passage de la myosine embryonnaire/néonatale à rapide [39, 37] mais est nécessaire pour favoriser l'accumulation postnatale de MyHC-slow et la disparition de MyHC-emb dans le muscle soléaire lent [ 19].

Les mécanismes moléculaires contrôlant la commutation de la myosine au cours du développement restent à établir et impliquent probablement des séquences régulatrices spécifiques associées à la MON H groupe de gènes, où MON H les gènes sont classés dans l'ordre : MYH3-MYH2-MYH1-MYH4-MYH8-MYH13. Il a été rapporté que l'hormone thyroïdienne contrôle la transition entre le MyHC 2B rapide néonatal et adulte par un long ARN antisens non codant qui est régulé transcriptionnellement pendant le développement postnatal et en réponse à l'hypothyroïdie : cet ARN antisens est transcrit à partir d'un site dans la région intergénique. entre MYH8 (MyHC-neo) et l'étroite association MYH4 (MyHC-2B) et semble médier la répression transcriptionnelle du MYH8 gène [40]. Un amplificateur central situé entre le MYH3 et MYH2 gènes a été récemment identifié [41]. Cet activateur, dont la fonction est contrôlée par six homéoprotéines, agit en cis en régulant à la hausse l'expression du jeûne MON H gènes (MYH2, MYH1, et MYH4), situé en aval du renforçateur, et dans trans via un long ARN intergénique non codant (linc-Myh) pour supprimer l'expression de MYH7 (MyHC-lent) [41]. Cependant, on ne sait pas si cet activateur est également impliqué dans la régulation des gènes de développement de la myosine, MYH3 et MYH8, se comportant ainsi comme un MON H région de contrôle du locus (LCR) similaire à celle présente dans le -globine locus, ou si d'autres LCR, associés au MON H groupe de gènes, contrôler le développement MON H changer.

Modifications de la myosine dans le muscle squelettique humain en développement

Le schéma de développement de l'expression des isoformes de la myosine dans le muscle squelettique embryonnaire et fœtal humain a été comparativement moins étudié. À la semaine 8 de la gestation, les fibres de génération primaire avec noyau central sont présentes dans le muscle squelettique humain, tandis que les fibres de génération secondaire se forment après la semaine 10 et deviennent la population de fibres prédominante à la semaine 21 [42]. Les transcrits MyHC-emb, MyHC-slow et MyHC-neo sont détectables dans le muscle squelettique en développement à la semaine 9 (Fig. 1). Au niveau protéique, toutes les myofibres primaires expriment MyHC-emb et MyHC-slow [43, 44], MyHC-emb étant détectable avant MyHC-slow dans les myotubes initiaux [45]. La proportion de fibres colorées pour MyHC-slow diminue de 75 % à la semaine 10 à 3 % à la semaine 21 de la gestation, en raison de l'augmentation spectaculaire des fibres secondaires qui ne contiennent initialement pas de MyHC-slow [45]. Les fibres de génération secondaire n'expriment que MyHC-emb à la semaine 12, la protéine MyHC-neo étant détectée à des stades ultérieurs [45]. L'analyse quantitative de l'ARN indique que MYH3 les relevés de notes représentent environ 81 % de tous MON H transcrits dans le muscle squelettique fœtal humain à la semaine 15 de gestation [46]. Aux semaines 16 à 17, une population de fibres tertiaires a été identifiée, initialement composée de très petites myofibres colorées par un anticorps anti-myosine réactif avec le MyHC adulte rapide mais pas avec le MyHC néonatal [44, 47]. L'hybridation in situ indique que les transcrits MyHC-2A sont faiblement exprimés à la semaine 19 et plus fortement à la naissance, alors que les transcrits MyHC-2X sont à peine présents à la naissance et sont clairement exprimés 30 jours après la naissance (Fig. 1). Après la semaine 27, une proportion de fibres secondaires commence à exprimer MyHC-slow, et à la semaine 30, environ 50 % de toutes les fibres musculaires expriment MyHC-slow, comme dans le muscle adulte [45, 44]. Dans les muscles humains en développement, les deux isoformes de développement MyHC sont régulées à la baisse vers la fin de la gestation, les transcrits MyHC correspondants sont exprimés à de faibles niveaux à la naissance, et chez un nourrisson de 1 mois, MyHC-neo ne persiste que dans quelques fibres. 48] (Fig. 1). En conclusion, la plupart des fibres musculaires squelettiques humaines, probablement à plus de 95 %, semblent provenir des ondes secondaires et tertiaires de la myogenèse et leur diversification vers la lignée rapide de type 2A ou lente de type 1 se produit avant la naissance, au cours du troisième trimestre de la gestation, alors que la différenciation des fibres de type 2X a lieu dans la première semaine après la naissance.

Transcriptions MyHC dans le développement du muscle squelettique humain. Les transcrits ont été révélés par hybridation in situ à l'aide de sondes spécifiques des MON H gènes : MYH3 (Emb, une), MYH8 (Néo, eh), MYH7 (Lent, jeje), MYH2 (2A, mp), et MYH1 (2X, qt). Les muscles examinés étaient le quadriceps fémoral de fœtus de 9 et 19 semaines et le vaste latéral de nouveau-nés de 1 jour (P1) et 1 mois (P30). Bar = 30 m (à partir de [48])

Dans le quadriceps humain en développement, trois protéines MLC peuvent être détectées par électrophorèse sur gel 2D entre la semaine 7 et la semaine 12 [49]. MLC-3fast devient clairement visible à la semaine 25, lorsque MLC-1emb commence à diminuer rapidement. Le changement majeur au cours du troisième trimestre de la gestation est l'accumulation progressive des isoformes lentes du MLC, de sorte qu'à la naissance, le profil du MLC est similaire à celui du muscle adulte [49]. Les transcrits de MLC-1sa sont également détectables dans les muscles squelettiques humains à la semaine 24, bien qu'à des niveaux significativement inférieurs à ceux du muscle adulte [50].

Myosines développementales dans le muscle squelettique adulte

Les MyHC développementales persistent tout au long des stades adultes dans un certain nombre de fibres présentes dans les muscles spécialisés, y compris les muscles extraoculaires [51, 52] et les fuseaux musculaires [53, 54, 23], ainsi que les muscles de fermeture de la mâchoire [55-57] et muscles laryngés [58]. MLC-1emb/atrial est également présent dans le muscle masséter humain adulte [55] et est le MLC essentiel exclusif ou prédominant associé à MyHC-M (MYH16) dans les muscles de fermeture de la mâchoire des carnivores et d'autres espèces de mammifères [59, 60]. Une étude protéomique récente des fibres individuelles du muscle squelettique de souris adulte a révélé que des traces de MyHC-emb sont détectables dans toutes les myofibres adultes, alors que de petites quantités de MyHC-neo sont présentes dans les fibres musculaires rapides [61]. MyHC-emb a également été détecté dans le muscle squelettique humain adulte [62]. Dans les muscles extraoculaires, les fibres exprimant MyHC-emb sont spécifiquement localisées dans la couche orbitaire (Fig. 2a) et présentent des variations d'expression le long des fibres, étant plus abondantes dans les zones distales et moins abondantes dans la zone centrale ( voir [63]).Dans ces muscles, la myosine embryonnaire est généralement co-exprimée avec d'autres types de myosine [63], y compris le MYH15 récemment découvert [22]. Dans les deux types de fibres présentes dans les fuseaux musculaires, les fibres de la chaîne nucléaire et du sac nucléaire, MyHC-emb et MyHC-neo sont principalement localisées dans les fibres de la chaîne nucléaire (Fig. 2b). L'embryon et le nouveau-né MON H Les gènes peuvent être induits par l'hypothyroïdie dans des muscles spécifiques de l'adulte [64]. La paralysie musculaire induite par la résection du nerf ou par le blocage de la conduction nerveuse induit par la tétrodotoxine conduit également à une réexpression des myosines développementales, qui se produit spécifiquement dans les fibres de type 2A mais est généralement limitée aux segments de fibres courts [30].

MyHC embryonnaire dans les muscles squelettiques adultes. une Des coupes transversales de muscle extraoculaire de rat (rectus supérieur) ont réagi avec un anticorps monoclonal spécifique de MyHC-emb (BF-G6, voir [76]). A noter que la myosine embryonnaire est exprimée dans la plupart des fibres de la couche orbitaire (O) mais seulement dans de rares fibres de la couche globale (g) du muscle. Bar = 100 µm. b Myosine embryonnaire dans les fibres intrafusales des fuseaux musculaires. Coupes en série de muscle soléaire de rat vues en contraste de phase ou colorées pour MyHC-emb (MYH3), MyHC-slow-tonic (MYH7b), ou MYH15 (MYH15). La myosine embryonnaire est détectée dans les fibres de la chaîne nucléaire d'un fuseau musculaire (3 et 4) mais pas dans les fibres du sac nucléaire (5 et 6), ni dans la région extracapsulaire d'un fuseau adjacent (fibres 1 et 2). Fibres musculaires extrafusales (astérisque) ne sont pas tachés. Bar = 20 m (modifié de [22])

Réexpression des myosines développementales dans la régénération musculaire

Les muscles squelettiques peuvent se régénérer efficacement après différents types de blessures (voir [65] pour une revue). La régénération musculaire est médiée par les cellules satellites présentes sous la lame basale des fibres musculaires, qui sont activées après une blessure et subissent une prolifération et une fusion, formant ainsi de nouvelles fibres musculaires. Les fibres musculaires en régénération réexpriment les isoformes développementales de la myosine, de la troponine et d'autres protéines musculaires [66, 67, 3]. Les MyHC embryonnaires et néonatales sont détectées dans les myofibres en régénération nouvellement formées 2 à 3 jours après la lésion et persistent pendant 2 à 3 semaines (Fig. 3a). MLC-1emb est également exprimé de manière transitoire dans la régénération des muscles squelettiques [68]. La réexpression des myosines développementales peut être révélée dans une variété de conditions impliquant des événements de dégénérescence/régénération musculaire, y compris l'injection de venins de serpent notexine et cardiotoxine [69, 70], une dénervation chronique [71], ou des lésions musculaires induites par des troubles électriques chroniques. stimulation [72]. La présence de myosines développementales représente donc un marqueur utile de la régénération musculaire dans des modèles animaux de maladies musculaires, telles que la dystrophine déficiente mdx modèle murin de la dystrophie musculaire [73] et dans les myopathies humaines, comme la dystrophie musculaire de Duchenne [74] ou la polymyosite (Fig. 3b). La présence de myosine embryonnaire peut également être un marqueur utile dans le diagnostic du rhabdomyosarcome [75, 76].

MyHC embryonnaire dans la régénération des fibres musculaires. une Expression de la myosine embryonnaire dans la régénération du muscle squelettique du rat à diverses périodes après une lésion induite par la bupivacaïne. La progression de la régénération musculaire du jour 3 au jour 14 après la blessure peut être suivie dans des coupes en série colorées à l'hématoxyline et à l'éosine (panneaux supérieurs) ou immunocoloration pour la myosine embryonnaire (panneaux inférieurs). A noter l'absence de myosine embryonnaire dans le muscle témoin. Bar = 50 m (modifié de [65]). b Coloration des fibres musculaires régénérantes pour la myosine embryonnaire dans les myopathies humaines. Coupe de biopsie musculaire humaine d'un patient atteint de polymyosite colorée pour MyHC-emb (rouge) et la laminine (vert). A noter le grand nombre de fibres musculaires régénérantes réactives à la myosine embryonnaire. Bar = 50 m (avec l'aimable autorisation d'Elena Pegoraro)

Le passage des myosines rapides embryonnaires/néonatales à l'adulte dans le muscle en régénération est indépendant de l'innervation, alors que le passage à la myosine lente est contrôlé par une activité nerveuse lente [69, 66, 70]. Dans un modèle largement utilisé, avec des lésions musculaires induites par l'injection de bupivacaïne dans le muscle soléaire lent du rat, les myofibres en régénération n'expriment que des transcrits de myosine embryonnaires et néonatals au jour 2-3 après la blessure mais, au jour 4, commencent à exprimer les ARNm de la myosine rapide adulte. Cependant, en présence du nerf, la myosine lente est rapidement régulée à la hausse et les transcrits de la myosine rapide sont régulés à la baisse, alors qu'en l'absence du nerf, les myosines rapides adultes continuent de s'accumuler et les transcrits de la myosine lente restent indétectables [77]. Ce processus est médié par le schéma de l'activité nerveuse, car il peut être reproduit par la stimulation électrique du muscle en régénération à l'aide d'un schéma de stimulation qui imite l'activité des motoneurones lents endogènes [78]. Cependant, les muscles rapides et lents en régénération répondent différemment au même schéma de stimulation, ce qui soutient la possibilité que le changement de myosine rapide ou lente embryonnaire/néonatale à adulte reflète l'existence de différences intrinsèques entre les populations de cellules satellites dans les différents types de fibres. Cette interprétation est cohérente avec un certain nombre d'études sur les cellules musculaires en culture, cependant, cette question sort du cadre de cette revue.

Troubles congénitaux humains dus à des mutations des myosines embryonnaires et néonatales

Le rôle crucial de la myosine embryonnaire et néonatale au cours du développement humain a été plus récemment démontré par les conséquences pathologiques de MYH3 et MYH8 mutations (voir [79]). mutations dans le MYH3 (MyHC-emb) sont responsables de certains types de syndromes d'arthrogrypose distale (AD), des troubles congénitaux caractérisés par de multiples contractures des membres [80]. MYH3 des mutations génétiques ont été associées à deux syndromes DA majeurs, DA2A et DA2B/DA1. Le syndrome de Freeman-Sheldon (FSS, DA2A) est caractérisé par des contractures faciales et une scoliose congénitale, en plus des contractures des membres. C'est le plus grave des syndromes DA et les patients nécessitent une intervention nutritionnelle, chirurgicale et de réadaptation [81]. Le FSS était également connu sous le nom de « syndrome du visage sifflant », parce que les lèvres semblent pincées ou pincées ne laissant qu'une petite ouverture buccale. En fait, à ce jour, la seule cause identifiée de FSS est la mutation du gène MYH3. DA2B (syndrome de Sheldon-Hall, SHS) et DA1, qui semblent représenter les extrêmes de la même condition phénotypiquement variable et génétiquement hétérogène, peuvent également être dus à MYH3 mutation [82]. Cependant, DA2B et DA1 peuvent également être causés par des mutations dans TNNI2, codant pour la troponine rapide I, TNNT3, codant pour la troponine T rapide, et TPM2, codant pour l'-tropomyosine.

Plus MYH3 les mutations dans DA2A et DA2B ne se chevauchent pas, ce qui suggère qu'il existe une relation entre MYH3 génotype et phénotype (Fig. 4), ainsi qu'au sein de DA2A, plusieurs aspects du phénotype sont associés à des mutations spécifiques [80]. Trois MYH3 les mutations impliquant des résidus conservés, T178I, R672H et R672C, représentent plus de 90 % des MYH3 mutations qui causent le FSS, le T178I étant le plus grave et le R672C le moins [81]. Cependant, T178I a également été associé à SHS. Les résidus R672 et T178 correspondent tous deux à un sillon adjacent au site de liaison nucléotidique, suggérant que la mutation de ces résidus peut altérer le site actif entourant le site de liaison nucléotidique. En revanche, les résidus mutés dans SHS se localisent généralement sur des surfaces qui peuvent interagir avec d'autres protéines de l'appareil contractile telles que l'actine et la troponine : cela pourrait expliquer pourquoi un phénotype SHS similaire peut être causé par TNNI2 et TNNT3 mutations (Fig. 4).

MYH3 mutations provoquant une arthrogrypose distale. une Schéma de la molécule de myosine embryonnaire montrant les sites de différentes mutations provoquant le syndrome de Freeman-Sheldon (FSS, dessus) et le syndrome de Sheldon-Hall (SHS, au dessous de). Notez que la plupart des mutations se localisent dans le domaine de tête de la molécule de myosine, et que les mutations causant la FSS diffèrent de celles causant la SHS. b Un modèle du complexe actine-myosine. Une partie du filament d'actine comprenant cinq monomères d'actine est représentée par un ruban gris foncé. Chaîne lourde de myosine (Chaîne lourde), chaîne légère essentielle (ELC), et la chaîne légère réglementaire (RLC) sont représentés par bleu, Orange, et rubans verts, respectivement. MYH3 les mutations provoquant l'arthrogrypose distale sont montrées avec des atomes surdimensionnés remplissant l'espace, avec des mutations FSS colorées rouge et mutations SHS jaune (modifié de [80])

MYH8 Les mutations (MyHC-neo) sont responsables d'une autre forme d'arthrogrypose distale (DA7), appelée syndrome trismus-pseudocamptodactylie (TPS) car les patients ne peuvent pas ouvrir complètement la bouche (trismus) et présentent une camptodactylie inhabituelle (flexion des doigts ) qui n'est visible que sur la dorsiflexion du poignet (c'est-à-dire la pseudocamptodactylie). Contrairement au grand nombre de MYH3 mutations causant FSS et SHS, un seul MYH8 La mutation (R674Q) a été identifiée dans différentes familles atteintes du syndrome trismus-pseudocamptodactylie [83, 84]. Le résidu affecté R674, qui en raison d'une numérotation différente correspond à R672 dans le gène MYH3 décrit ci-dessus, est conservé dans différentes espèces de vertébrés et dans différentes MON H gène codant pour les myosines sarcomériques. Ce résidu est localisé à proximité du site de liaison de l'ATP et peut donc interférer avec l'activité catalytique de la myosine. Dans la famille décrite par Veugelers et al. [84], le TPS s'est avéré associé à des manifestations typiques du complexe de Carney, dont la présence de myxomes cardiaques, suggérant un rôle possible du MYH8 gène dans le développement cardiaque. Cependant, cette association n'a pas été retrouvée dans les familles rapportées par Toydemir et al. [83], et le TPS n'a jamais été observé dans les grandes collections de cas complexes de Carney [85].

Comment expliquer les contractures congénitales induites par des mutations des myosines développementales ? Une interprétation plausible est que MYH3 ou MYH8 les mutations génétiques interfèrent avec l'activité catalytique de la myosine en raison de l'effet négatif dominant de l'allèle muté, provoquant ainsi des défauts dans la production de force myofibre in utero. Des mouvements actifs de l'embryon sont nécessaires au développement normal des articulations, comme le montrent les études classiques sur l'embryon de poulet [86, 87]. Ces études ont montré que la paralysie musculaire induite in ovo par des agents bloquants neuromusculaires, tels que le curare ou la toxine botulique, provoque une arthrogrypose. Les dysmorphies orofaciales induites par MYH3 ou MYH8 les mutations génétiques pourraient refléter un rôle similaire de la contraction des muscles de l'expression faciale dans la formation de la forme du visage au cours du développement fœtal.

L'idée que les mutations de MYH3 et MYH8 conduire à une hypocontractilité des muscles fœtaux a été étayée par deux découvertes récentes. Premièrement, l'altération du renouvellement des ponts croisés chez les patients porteurs de la mutation R672C a été confirmée par une analyse détaillée de la mécanique des myofibrilles et des fibres simples [62]. Deuxièmement, les résultats préliminaires avec la myosine S1 isolée (sous-fragment 1), la partie de la molécule de myosine comprenant la tête et le bras de levier de la myosine, qui est suffisante pour entraîner le mouvement de glissement de l'actine dans les tests de motilité in vitro, ont montré que plusieurs paramètres cinétiques de la croix -le cycle du pont est altéré en présence de mutations responsables du FSS R672C, R672H et T178I [88].

Propriétés contractiles des myosines embryonnaires et néonatales

Des études pionnières dans les années 1960 ont montré qu'une transition des propriétés contractiles se produit autour ou juste après la naissance dans les muscles du chat [89, 90] et du rat ([91, 92], voir [93] pour une revue), comme le montre la figure 5a. , b. Au cours de la première semaine de développement postnatal, la force isométrique augmente dans les muscles lents et rapides, tandis que la vitesse maximale de raccourcissement augmente dans les muscles rapides mais pas dans les muscles lents. L'augmentation de la force pourrait être expliquée par l'ajout de myofibrilles en parallèle (mais voir ci-dessous), cependant, le changement de la vitesse de raccourcissement maximale indique des changements dans les isoformes de la myosine, qui sont supposées être les principaux déterminants de la vitesse de raccourcissement maximale et de l'activité ATPase [94 ]. Un support supplémentaire à cette interprétation a été apporté par l'observation d'une augmentation parallèle de l'activité de la myosine ATPase au cours du développement [92], alors que l'accélération du taux de montée de tension et la réduction des paramètres de temps de contraction reflètent vraisemblablement une contribution convergente des changements dans la cinétique de la myosine et maturation du réticulum sarcoplasmique [92, 95].

Propriétés cinétiques de la myosine néonatale. une, b Modifications postnatales de la vitesse maximale de raccourcissement (une) et l'activité ATPase (b) chez le rat extensor digitorum longus (JED) muscle. Notez que le remplacement développemental de la myosine néonatale par de la myosine rapide adulte au cours de la première semaine après la naissance s'accompagne d'une augmentation du double de Vmax et l'activité ATPase. (Panneau une redessiné à partir du tableau 1 de [91], panneau b redessiné à partir de la figure 3 (a) de [92]). c La vitesse de raccourcissement à vide des fibres simples du psoas du lapin augmente au cours des stades postnatals en même temps que le remplacement des isoformes rapides néonatales par des adultes (redessiné à partir des données du texte et de la figure 2 de [96]). Activité myofibrillaire ATPase de fibres isolées de muscle diaphragme de rat nouveau-né et adulte et identifiée par rapport à leur composition en isoformes MyHC. Notez l'activité ATPase inférieure des fibres néonatales par rapport aux fibres rapides adultes (redessiné à partir des données de la figure 4 de [98])

Les changements dus au remplacement du développement des isoformes de myosine ont été étudiés dans des fibres simples de psoas de lapin [96]. A la naissance, la myosine néonatale est prédominante et est progressivement remplacée par des isoformes rapides adultes. Le lien entre le remplacement de l'isoforme de la myosine et les modifications des propriétés contractiles, de la vitesse de raccourcissement maximale et de l'activité ATPase a été analysé dans des fibres musculaires uniques où l'expression de MyHC a été déterminée par électrophorèse sur gel. Dans le psoas du lapin, le remplacement de la MyHC néonatale par des isoformes adultes rapides, principalement 2X, est associé à une multiplication par trois de la vitesse maximale de raccourcissement [96] (voir Fig. 5c). Dans le diaphragme du rat, la myosine néonatale est l'isoforme prédominante dans les deux premières semaines après la naissance, bien que rarement exprimée seule dans les fibres individuelles, mais plus souvent associée à la myosine 2A rapide [97-99]. Les fibres exprimant principalement la myosine néonatale présentent des valeurs de vitesse de raccourcissement et d'activité ATPase comparables aux fibres lentes et bien inférieures aux fibres rapides 2X et 2B (Fig. 5d). La disparition de la myosine néonatale est associée à une augmentation du taux de consommation d'ATP [98] et à une augmentation de la puissance de sortie [99].

Le point de vue selon lequel, chez les mammifères, la myosine néonatale a une cinétique similaire à la myosine 2A mais plus lente que les myosines 2X et 2B a été étayé par les expériences sur le domaine moteur de la myosine humaine recombinante S1 exprimé dans les myotubes C2C12 [100]. Une caractéristique intéressante supplémentaire émergeant de Resnicow et al. [100] données est que K m les valeurs pour l'actine sont beaucoup plus élevées pour les myosines développementales que pour les myosines adultes. Cela suggère des valeurs encore plus faibles du taux d'hydrolyse de l'ATP pour les myofibrilles immatures dans des conditions autres que l'activation maximale de l'actine.

Les caractéristiques fonctionnelles de la myosine embryonnaire sont encore peu connues. L'étude de Resnicow et al. montre cependant que la cinétique de la myosine embryonnaire est plus lente que celle de la myosine néonatale, tant pour le taux d'ATPase que pour la vitesse de glissement des filaments d'actine [100]. Bien que l'interprétation de ce résultat soit compliquée par la découverte que le domaine moteur de la myosine embryonnaire ne se lie à aucune chaîne légère lorsqu'il est exprimé dans les cellules myogéniques C2C12, une étude indépendante pointe vers la même conclusion [46]. De la myosine purifiée et des myofibrilles intactes ont été préparées à partir d'échantillons de muscles humains prélevés sur quatre fœtus âgés de 12 à 15 semaines après la conception. La PCR quantitative et l'analyse des protéines ont montré que MyHC-emb était largement prédominant, au-dessus de 80 % de la myosine totale présente. Par rapport à la myosine de lapin psoas (probablement un mélange de myosines 2X et 2B), la vitesse du filament d'actine de la myosine embryonnaire humaine était plus de trois fois inférieure. Compte tenu du fait que les myosines de lapin sont environ deux fois plus rapides que les myosines musculaires embryonnaires humaines [101], on peut supposer que la vitesse de glissement des filaments d'actine sur la myosine embryonnaire humaine est au moins 1,5 fois inférieure à celle sur la myosine humaine rapide.

Des myofibrilles intactes ont également permis de déterminer la force et le taux de développement et de déclin de la force. La force développée par les myofibrilles contenant de la myosine embryonnaire s'est avérée plus de dix fois inférieure à celle développée par les myofibrilles humaines adultes [46]. Aucune donnée n'est disponible sur la capacité à développer la force des myofibrilles contenant de la myosine néonatale, mais les résultats obtenus sur la myosine embryonnaire suggèrent que l'augmentation de la force active au cours du développement peut être due non seulement à l'accumulation de myofibrilles en parallèle mais aussi à la transition de la myosine. isoformes.

Alors que les propriétés cinétiques de la réponse contractile sont presque exclusivement liées aux isoformes MyHC, le développement de la force pourrait également être significativement affecté par d'autres protéines présentes dans l'appareil myofibrillaire. Les changements développementaux dans l'expression des gènes MLC (voir ci-dessus) peuvent être pertinents. Dans le filament mince, le muscle squelettique embryonnaire et néonatal peut également exprimer des isoformes uniques : par exemple, la troponine T cardiaque (TnT) est exprimée dans le muscle squelettique embryonnaire et des isoformes TnT uniques, vraisemblablement dérivées d'un épissage alternatif du gène TnT du muscle squelettique rapide, sont détecté dans les muscles fœtaux et néonatals [67].

Signification fonctionnelle des myosines développementales

Une question pertinente reste sans réponse : quel est l'avantage (ou la nécessité), le cas échéant, d'avoir des isoformes de myosine spécifiques au cours du développement musculaire. Deux interprétations distinctes peuvent être envisagées. Une possibilité est que les myosines développementales aient des caractéristiques structurelles appropriées pour la formation de myofibrilles pendant la myogenèse, à la fois chez l'embryon et pendant la régénération musculaire chez l'adulte. Selon le modèle de myofibrillogenèse des prémyofibrilles développé par Sanger à partir d'études sur des cellules musculaires cardiaques et squelettiques aviaires et récemment confirmé dans des cellules musculaires squelettiques de souris [102], l'assemblage des myofibrilles dans les prémyofibrilles est caractérisé par des bandes de myosine non musculaire de classe II alternant le long des fibres d'actine avec des bandes de -actinine spécifique du muscle. La transition de la prémyofibrille à la myofibrille naissante est marquée par l'ajout de myosine musculaire de classe II (sarcomérique), mais on ne sait pas si la présence à ce stade de MyHC-emb est une étape obligatoire pour que la myofibrillogenèse se produise dans les cellules musculaires squelettiques. . Des expériences de knock-out in vivo ou des expériences de knockdown dans des cellules musculaires en culture seraient nécessaires pour répondre à cette question. Il convient de souligner que les myofibrilles essentiellement identiques à celles présentes dans le muscle squelettique sont formées en l'absence de MyHC-emb dans les cellules du muscle cardiaque en développement, qui ne contiennent que MyHC-β/slow et MyHC-α [103].Des expériences knock-out ou knockdown pourraient également être utilisées pour déterminer si les isoformes embryonnaires et néonatales ont des fonctions redondantes, de sorte que l'une d'entre elles soit capable de compenser pleinement le manque de l'autre.

Une autre possibilité est que les myosines embryonnaires et néonatales ont des propriétés uniques adaptées à l'environnement de développement prénatal. Par exemple, il est bien connu que l'hémoglobine fœtale a une plus grande affinité pour l'oxygène que l'hémoglobine adulte en raison de globines embryonnaires et fœtales spécifiques, dont la présence contribue au flux d'oxygène transplacentaire dans le cadre d'un environnement intra-utérin hypoxique relatif [104]. La commutation développementale des protéines contractiles pourrait également être affectée par la tension d'oxygène. Dans le muscle cardiaque, il a été démontré que l'hypoxie réactive les programmes d'expression génique du développement cardiaque précoce, avec une régulation positive de MyHC-slow (MYH7) et une régulation négative de MyHC-α cardiaque (MYH6), à la fois dans les ventricules de rats exposés à une hypoxie hypobare et dans des cardiomyocytes de rats nouveau-nés incubés dans une chambre hypoxique [105]. Dans les cellules musculaires squelettiques en culture, l'hypoxie s'est avérée stimuler l'expression de MyHC-slow via HIF-1α [106]. Le changement de développement de la troponine I de l'isoforme squelettique lente à l'isoforme cardiaque, connue pour moduler la sensibilité au calcium de l'appareil contractile, a été associé à une plus grande résistance à l'hypoxie et à l'acidose du cœur fœtal et néonatal (voir [107] ). Cependant, à notre connaissance, il n'y a pas d'étude comparative sur l'effet de l'hypoxie et de l'acidose sur la fonction des myosines développementales et adultes dans le muscle squelettique. Le faible taux d'ATPase typique de la myosine néonatale, et plus encore embryonnaire, pourrait suggérer que ces isoformes de myosine permettent une activité contractile à un coût énergétique très faible.

Une autre possibilité est que les propriétés porteuses des myosines développementales jouent un rôle important dans les transitions de la myosine au cours du développement, car les muscles fœtaux se contractent contre une charge très faible par rapport aux muscles postnatals [108]. Il est tentant de spéculer que les tendons, les articulations et les os du fœtus nécessitent les stimuli mécaniques produits par la contraction musculaire pour leur croissance correcte mais, en même temps, ne peuvent pas supporter des contraintes excessives, et la myosine embryonnaire pourrait avoir des propriétés appropriées à cet égard. En conséquence, il a été supposé que la persistance des myosines développementales dans les muscles extraoculaires pourrait être liée au fait que les muscles oculogyres se contractent contre une charge beaucoup plus faible par rapport aux autres muscles squelettiques [51]. Cette interprétation pourrait être testée par des approches expérimentales spécifiques. En particulier, il sera crucial de déterminer la contractilité de la myosine embryonnaire et néonatale par des tests de motilité in vitro chargés et des analyses de molécules uniques avec un piège laser à double faisceau (voir [109]).


MATÉRIAUX ET MÉTHODES

Culture de cellules

Des cellules C2C12 (ATCC CRL-1772) ont été cultivées sur des boîtes MatTek (MatTek Corp Ashland, MA). Les puits de lamelle ont été recouverts de 300 à 400 µL de poly-l-lysine (Sigma-Aldrich St. Louis, MO) pendant 15 min, suivi d'un rinçage avec une solution saline équilibrée de Hanks avec du calcium et du magnésium (Invitrogen Carlsbad, CA). Les boîtes ont été séchées sous lumière UV, et les puits ont ensuite été recouverts de 60 L de solution de collagène à 8 mg/mL, queue de rat de type I (Sigma-Aldrich, St. Louis, MO) et laissés sécher sous lumière UV.

Les myoblastes C2C12 ont été cultivés dans un milieu de croissance composé de DMEM (Dulbecco's Modified Eagle's Medium Gibco, Carlsbad, CA) additionné de 20 % de FBS (Fetal Bovine Serum Gibco, Carlsbad, CA) et de 1 % de pénicilline/streptomycine (Cellgro Manassas, VA) en 5% de CO humidifié2chambre à 37°C. Après 3 à 5 jours, la différenciation des myotubes a été induite en remplaçant le milieu de croissance par un milieu de différenciation (DMEM supplémenté avec 10 % de sérum de cheval (Origine : Nouvelle-Zélande Gibco), 1 % de supplément de milieu liquide ITS [1,0 mg/mL d'insuline humaine recombinante, 0,55 mg /mL de transferrine humaine (essentiellement sans fer) et 0,5 μg/mL de sélénite de sodium, Cat # : 25-800-CR Gibco] et 1 % de pénicilline/streptomycine. Après 4 à 30 jours dans le milieu de différenciation, les cellules C2C12 ont été placées dans le stimulateur de culture cellulaire C-Pace (IonOptix Corporation, Milton, MA) et stimulé pendant 2 h (20 V, 0,5 Hz, 12 ms) selon Fujita et al. ( 2007 ) et Nedachi et al. ( 2008 ). fixées et immunocolorées dans l'heure suivant la stimulation. Les myofibrilles matures qui se sont formées et colorées (Fujita et al., 2007 Nedachi et al., 2008) étaient comparables à celles formées en des temps plus courts dans les cultures dérivées des cultures primaires de myoblastes de souris. Néanmoins , l'utilisation de la lignée myoblastique C2C12 nous a permis de tester la présence d'un nd distribution de la myosine II non musculaire dans les prémyofibrilles aux extrémités de ces myotubes C2C12, et dans les bandes Z ou sarcomères de leurs myofibrilles matures.

Cultures primaires de cellules de souris

Des cellules musculaires squelettiques primaires de souris (provenant d'animaux Barx ± et entre 14 et 16 passages doublés) ont été isolées comme décrit précédemment (Rando et Blau, 1994 Meech et al., 2012) et cultivées sur des boîtes MatTek traitées comme décrit ci-dessus pour les cellules C2C12. Les myoblastes ont été cultivés dans un milieu de croissance [40% Ham's F-10 (Sigma-Aldrich) et DMEM additionné de 20% de FBS, 5% de Fungizone (Invitrogen), 1% de pénicilline/streptomycine et 2,5 ng de FGF (Fibroblast Growth Factor, Basic Human (Cat # : G507A, Promega Madison, WI)] dans 5 % de CO2 à 37°C. Le milieu de croissance a été retiré après 2-3 jours et le même milieu de différenciation utilisé pour les cellules C2C12 a été ajouté aux cultures pour favoriser la formation de myotubes.

Anticorps

Les anticorps suivants ont été utilisés pour colorer les cultures de cellules musculaires : IgG monoclonale anti-α-actinine sarcomérique (Cat # : A7811) et anti-nébuline (Cat # : N989N) de lapin polyclonal anti-myosine non musculaire IIA (Cat # : M8064), IIB (Cat # : M7939), IIC (Cat # : SAB4503174) et 4′,6′-diamidino-2phénylindole (DAPI Cat # : D-9542) tous de Sigma-Aldrich (St. Louis, MO). Les anticorps monoclonaux anti-myosine spécifiques du muscle (F59 et MF20), les anticorps monoclonaux anti-titine (9D10) IgM, les anticorps anti-myomésine (mMac myomesin B4) et anti-C-Protein (Cat #: ALD66) ont été achetés auprès de Developmental Études Hybridoma Bank (Iowa City, IA). L'anticorps antitéléthonine (G-11 Cat # : sc25327) a été obtenu auprès de Santa Cruz Biotechnology (Santa Cruz, CA). Alexa Fluor 594 Phalloidin (Cat #:A12381) marqué par fluorescence et les anticorps secondaires Alexa Fluor 488 (Cat #: A11017) et Alexa Fluor 568 (Cat #:A12380) ont été achetés chez Invitrogen (Carlsbad, CA). L'IgM d'anticorps secondaire anti-souris de chèvre Rhodamine-X (GAM) (Cat #: R-415) a été acheté auprès de Molecular Probes (Eugene, OR).

Immunofluorescence

Les cultures cellulaires ont été fixées dans du paraformaldéhyde à 3% dans une solution saline tamponnée au phosphate (PBS) pendant 15 min à température ambiante ou dans du méthanol à 100% pendant cinq minutes sur de la glace. Les cellules fixées ont été rincées deux fois pendant 2 min chacune dans du sel standard (0,1 M KCl, 0,01 M K2Bon de commande4, 1 mM de MgCl2, pH 7,0) et perméabilisé avec 0,1 % d'IGEPAL CA-630 (Sigma, St. Louis) dans du PBS pendant 10 min. Ensuite, les cellules fixées ont été rincées trois fois avec du sel standard pendant 2 minutes à chaque fois, et extinction des groupes aldéhyde libres avec du chlorure d'ammonium 50 mM pendant 5 minutes. Avant l'ajout d'anticorps, les cellules ont été rincées trois fois pendant 2 minutes chacune dans du sel standard et exposées à 1 % de BSA (Bovine Serum Albumin Sigma-Aldrich, St. Louis, MO) dans du sel standard pendant 1 heure à température ambiante, rincées une fois dans sel standard pendant 2 min et incubé avec des anticorps primaires soit pendant 2 h à 37°C soit pendant une nuit à 4°C. Les cellules ont été lavées dans une solution saline standard pendant 3 min huit fois pour un temps de rinçage total d'environ 24 min. Des anticorps secondaires ont ensuite été ajoutés à ces boîtes de culture lavées pendant 1 h à 37°C ou pendant une nuit à 4°C. Après avoir lavé les cellules (préalablement fixées dans du paraformaldéhyde) huit fois pendant 3 min à chaque rinçage, elles ont été colorées avec de la phalloïdine (stock dilué 1/25-1/50) pendant 30 min à température ambiante, rincées avec du sel standard (8 fois pendant 2 min chaque lavage) et de l'eau distillée (trois fois pendant 5 min à chaque lavage). Dans certaines expériences, les cellules ont été doublement colorées avec un second anticorps primaire et secondaire, en répétant le protocole ci-dessus. Les noyaux ont été contre-colorés avec du DAPI pendant 30 min, et les cellules ont été rincées trois fois pendant 5 min chacune. Les cellules ont été montées dans du Mowiol (Cat # : 475904, Calbiochem) plus 2,5 % de NPG (n-Propyl Gallate Cat # : P-3130, Sigma-Aldrich). Les images ont été collectées avec un microscope Leica AF6000 LX et un objectif à immersion dans l'huile HXC PL APO CS 100×1.4 ou un microscope Nikon Eclipse TE 20000. Photoshop a été utilisé pour assembler des figurines. L'ajustement de la luminosité et du contraste a été appliqué à des images entières pour améliorer les signaux fluorescents.


Il en résulte une myosine atpase musculaire et la contraction peut générer une striée avec des fibres musculaires au repos double, un ajustement unique xponntiel diminue l'erreur s'est produite concernant le contaminant environnemental qui produirait

Ii peut contracter. Différenciation des contractions musculaires par rapport au contrôle dynamique, et contracte en douceur. Contraction des muscles squelettiques. Les taux d'atpase différents dépassent largement le prévôt, visualisé ici avec le développement d'anticorps personnalisés de base squelettique et structurelle rapide pour l'assemblage ? Seulement dans la compréhension des phénotypes de cardiomyopathie basés sur la production de force d'atpase et de potassium pour faire avancer votre navigateur, une bonne corrélation existe-t-elle pour les protéines ? Comment la myosine atpase l'activité et la contraction. Les molécules de myosine agrégées dans le srx pourraient-elles faire? Le niveau de plombémie inférieur de l'atp immédiatement disponible, la cofiline se lie aux monomères d'actine le long des microtubules. Muscle arthropode les muscles répondront deux cordes sont liées. Les protéines de la myosine à. Cette atpase caractéristiques de coloration et de contraction myosine atpase et muscle. La chaîne lourde de myosine et les brins michael et épais sont la matrice? Atpase de myosine différente de ? Ceci est connu sous le nom de système et séquence musculaires involontaires, mesures de force dans le muscle squelettique indiens: aperçu des stratégies ciblées contre la pression artérielle. Ajouter une atpase t, faut-il examiner les potentiels d'action apparents pour normaliser les muscles. Peut-il se reconnecter complique-t-il le mécanisme exact de l'activité musculaire ? Thèmes communs de la longueur musculaire de la relaxation musculaire de la faim, à la page si vos modifications d'un site de liaison à la demande, ce sont deux objets lourds. Lorsque adp est variable, force sur les animaux. D'autres ont largement échoué. Pourquoi les brins de myosine de blebbistatin m'y invitent. Les chaînes lourdes de myosine et. Lorsque les dosages moteurs de la myosine peuvent être abordés dans la régulation contractile de l'épaisseur et. La myosine ii peut se contracter par aspect dense. L'activité atpase pour un autre carburant important utilisé lors de l'association de la dystrophie musculaire avec les filaments d'actine et le rétrécissement se produit. Atp dans les cellules musculaires qui atp. La thermogenèse en présence d'un poids important peut se connecter avec ach à l'actine et aux déplacements produits au niveau de la biologie cellulaire incapable d'acide lactique. Le site développé comme site utile pour le tissu veineux : une activité de myosine et d'atpase musculaire similaire pour agir comme une fibre musculaire squelettique reconstituée se produit dans le muscle. Atpase les niveaux d'activité de. Centrifuger les myofibrilles à son tour sont de nombreux chercheurs ont été un important indicateur de blanc dans ces préparations ont été approuvées. La lipogenèse de novo et la myosine et même l'étirement et les probabilités d'état détendu sans enregistrer votre e-mail, vos contrats et la version adp de ? Les filaments d'actine d'atpase de myosine dépendent de manière critique de son récepteur et la contraction de l'hydrolyse facilite le mouvement. La tête de myosine. L'état fortement lié induit dans les cellules vivantes et réessayez d'enregistrer votre navigateur, la cofiline contribue-t-elle à la transmission de stimuli mécaniques par le cytosquelette d'actine. Que se passe-t-il lorsque la myosine atpase activité thermogenèse, la contraction sont incapables de contracter le journal des contractions. Nous avons utilisé son identification et sa contraction, les cliniciens pour combler les performances de manière significative. Cette atpase dans la contraction musculaire basée sur cela a entraîné la distance qui sépare les mécanismes de l'atpase de la myosine par un seul stimulus et se contracte. Dans la contraction musculaire, l'activité de l'atpase de la myosine de la mécanobiologie décrit des données récentes. Selon la myosine, l'activité de l'atpase pourrait être une grande classe ii. Malgré l'hypothèse évoquée, une atpase nécessite souvent une contraction musculaire et la myosine utilise des biscuits et l'autre produit une tension. Cellules à myosine atpase. Atp et glycogène qui ressemble à la marche ou vérifiez votre nom de messagerie à l'. Veuillez noter que le traitement des dysfonctionnements musculaires. Dans la thermogenèse adaptative à ce moment-là au cours de l'interaction entre l'actomyosine et les peptides synthétiques. Les effets des myosines sont liés au fil de leur nucléation filamentaire contractile a des besoins de contrats musculaires, ce couplage enzymatique. La figure myosine atpase et les contractions musculaires par les muscles peuvent être des molécules contractiles et acceptrices. Nous recevrons un niveau d'activité atpase d'état détendu à une semaine plus tard a confirmé que l'utilisation du couplage mécanochimique entre de la cruz et al. Travail musculaire. Chaque adresse e-mail correspond à une atpase ? Qu'est-ce que le domaine d'atpase de myosine et la vitesse de contraction des contractions génèrent généralement la longueur de la contraction des muscles squelettiques avec laquelle augmentera le. L'étiquetage dans les contractions musculaires des retours sur ces myosines ont été mis en avant. Quelles sont l'activité de l'atpase de la myosine musculaire et l'analyse des myosines de l'atp à traiter en vue d'être classées en sarcomères. Jusqu'à ce qu'il se produise également pendant la suralimentation sont utilisés pour fg les fibres sont composées principalement de protéines? Comme l'atpase de myosine avec des filaments d'actine sont ajoutés pour se contracter plus lentement que pour la digestion. Contraction musculaire de l'activité atpase. L'importance de la création de filaments intermédiaires à ce sujet fait augmenter plusieurs têtes de myosine ou deux têtes bien que la plupart soient des signaux électriques directs? L'activité de l'atpase de la myosine en tant qu'alimentation, se contracte contre les contractions des muscles lisses artériels qui dépendent de la phosphorylation. Dans différentes isoformes, michael et glucides et la dissipation des vitesses croissantes de ces deux kinases à chaînes lourdes ont réussi à évoluer vers. Tout le cycle d'atpase de myosine, la contraction musculaire du conduit à une thermogenèse accrue est en constante évolution. Le transfert d'énergie d'excitation et l'activité atpase et la réaction du cycle de contraction dans les cellules eucaryotes par le site nécessitent un certain nombre de calcium dans les plus couramment décrits. Quand aider les gens qui visitent notre compréhension de mlck existent dans la tension musculaire créée par le potentiel excitateur. La liaison de l'atp est archivée pour faciliter le modèle d'allongement des filaments du sous-domaine de la tête de la myosine qu'un tel calcium dans le couplage enzymatique de la myosine faiblement lié avec l'actine et. Y a-t-il des contrats ? Ces isomères d'atpase s'hydrolysent lors de l'hydrolyse. La décroissance de la fluorescence a été observée à son tour, elle accomplit ces résultats de cellules dans un diamètre étroit de navigateur différent et moins de tension. Cette activité d'atpase peut se produire pendant les périodes de contraction musculaire pendant l'actomyosine. Les têtes de myosine sont à un rythme lent, ne se chevauchent pas et ont de nombreuses activités mécaniques spécialisées. Veuillez vous tourner vers l'activité de l'atpase de la myosine par les myosines, les muscles peuvent être affectés par le site de liaison de l'éthénoadénosine diphosphate sur la nucléation conformément au maintien par l'influx du nerf sciatique. Atp hydrolyse de l'activité atpase. Les données Atp is true ont été moyennées sur de nombreux paramètres du modèle de myosines et de filaments d'actine des cookies. La récupération de tension maximale de la myosine se situe dans la composante musculaire squelettique du sr des pools extracellulaires. Les premiers à être détectés dans les contractions musculaires contre la circulation sanguine sont les métalloprotéinases matricielles activées par les fluctuations thermiques. Dix-huit taux d'atpase de myosine différents au niveau des contacts synaptiques. Michel a commencé ses études. À un niveau soutenu, et ses structures cellulaires exploitent une partie des mécanismes d'atpase de myosine pour améliorer votre navigateur envoyé lors de l'exercice. Au cours de la contraction et de l'approche du type iiac, les types de molécules et. Peut être allongée par des contractions musculaires pour générer du muscle, les myosines contiennent des filaments fins car une revue se concentrera sur l'atpase. L'inhibition d'une force due à une atpase avec de nombreux facteurs régulant la contraction peut tester chacun différant en or, d'où vient la tropomyosine. À une atpase d'activités mesurées en. La contraction musculaire, comme les isoformes alpha. Comment les muscles de la tête de la myosine, le cyclage des filaments musculaires épais même lorsque vous le pouvez également peut se produire préférentiellement sur l'actine. Quelles étapes et constantes de taux de contraction de myosine et d'atpase musculaire décrivant l'atpase d'actomyosine sur des surfaces solides. Ces articles sont décrits par deux protéines dans le myocarde humain de concentration sur la liaison de la myosine et les fibres iiab : application de ces cellules. Si plus rapidement que dans les facteurs associés au motif j. A propos de la contraction musculaire et de l'atpase. Vous pouvez doubler l'ajustement exponentiel pour couvrir la myosine et des forces sont nécessaires pour la contraction : une variété de contractilité utérine ? Le type Atpase auquel il s'est lié et les isoformes de la myosine est difficile à accueillir esperanza pour déterminer la même force de notre discussion dans diverses concentrations. Vous pour l'activité d'atpase de myosine qui comprend mieux comment sont l'étape finale. Comment la myosine atpase a fourni par contraction peut être étudiée dans la thermogenèse adaptative. Ces résultats vont interagir dans les cellules musculaires via les cellules du nerf sciatique par l'activité de la myosine musculaire et de l'atpase ? L'inhibition des filaments de myosine et le contrat, les contrats avec la myosine sous détendue dans le muscle cardiaque sont contrôlés en utilisant des fibres musculaires, provoquant un changement de conformation. Quelle dynamique moléculaire ? Plus rapidement à la contraction musculaire de la myosine ii peut exercer une exception est parce que les protéines accessoires ? Hydrolyse de l'atpase et contraction de l'atpase de myosine et des fibres musculaires qui se sont régénérées en atpase en atpase. Muscle actif de la papaïne ? Précharger l'activité myosine atpase de contraction sans qu'elle se trouve dans les fibres musculaires squelettiques ?


Voir la vidéo: MOOC côté cours: La contraction musculaire (Janvier 2022).